Journal of ISSN: 2373-437XJMEN

Microbiology & Experimentation
Research Article
Volume 2 Issue 3 - 2015
Loop Mediated Isothermal PCR (LAMP) for the Detection of Borrelia from Blood Cultures
Sheila Wood* and Aki Datar
Advanced Laboratory Services, USA
Received: April 13, 2015| Published: June 03, 2015
*Corresponding author: Sheila Wood, Advanced Laboratory Services, 501 Elmwood Ave, Sharon Hill, 19079 Pennsylvania, USA, Tel: 484 494 6125; Fax: 484 494 6800; Email: @
Citation: Wood S, Datar A (2015) Loop Mediated Isothermal PCR (LAMP) for the Detection of Borrelia from Blood Cultures. J Microbiol Exp 2(3): 00047.DOI: 10.15406/jmen.2015.02.00047

Abstract

Borrelia organisms were harvested from blood culture and tested using single primers and loop mediated isothermal PCR (LAMP). Samples were harvested at either 6 days or at 8 weeks and DNA was extracted using one of three methods. In addition, pre-processing steps included Liberase treatments to release organisms from any residual attached collagen and human DNA removal. Combinations of processes were used to determine the best procedures for harvesting organisms, processing the pellet, and extracting DNA prior to using PCR. Of the total number of positive signals obtained, 9 of 45 (20%) gave positive signals when using plasmid primers specific for B. burgdorferi, 14 of 40 (35%) were positive when using OspC primers, and 25 of 47 (53%) were positive when using LAMP primers for the DNA that codes for 16S rRNA.

Keywords: LAMP; Borrelia; Liberase

Abbreviations

LAMP: Loop Mediated Isothermal PCR; ALSI: Advanced Laboratory Services, Inc.; CLSI: Clinical Laboratory Standards Institutes

Introduction

The causative agent of Lyme disease, Borrelia burgdorferi, has proven to be difficult to culture in the laboratory. While organisms from ticks are routinely cultured in research labs using BSK media, the human pathogen found in the bloodstream is difficult to culture in artificial media. Advanced Laboratory Services, Inc. (ALSI) uses a modified blood culture media containing BSK-H, 12% rabbit serum and a collagen matrix [1]. The culture media is inoculated with the patient’s blood and both short term (6 days) and long term cultures (8 to 16 weeks) are established. The 8 week to 16 week culture contains the collagen matrix. The use of this collagen matrix enhances the growth of Borrelia in the artificial laboratory culture media.

The positive control that is used to monitor these cultures is B. burgdorferi B31 ATCC 35210, originally isolated from an Ixodes dammini tick in New York. It is the type strain for B. burgdorferi,does not contain lipopolysaccharide, survives in experimentallyinfected human blood, is known to cause Lyme disease, is culturedat 34 °C in BSK-H media under microaerophilic conditions, growsat three to five days, and its genome has been sequenced. The negative control, Escherichia coli ATCC 25922, is designated FDA strain Seattle 1946 Serotype 06, Biotype 1. It does not produce verotoxin and is used as a Clinical Laboratory Standards Institute (CLSI) strain for antimicrobial testing and for microbial identification in automated testing devices.

Investigators have used PCR to target Borrelia species found in ticks. These methods have included the use of nested primers, single tube nested primers [2], non-nested primers, and real time PCR to amplify Borrelia DNA. Such techniques were used to amplify DNA from ticks found in Norway, Germany and Austria. The genetic targets in these studies included intergenic spacer regions, OspA and the flagellin gene [2-4]. LAMP technology has been used to target organisms directly from blood and to identify organisms grown in the laboratory [5,6].

In our study, LAMP was used to amplify small amounts of DNA in the presence of inhibitors from patient blood cultures. LAMP primers were designed to detect DNA that codes for the 16S ribosomal unit of B. burgdorferi. Two other primer constructions were also tested on prepared samples. These primers were directed against the DNA that codes for the surface antigen OspC [7] and DNA specific for B. burgdorferi that is carried on a stable plasmid (personal communication, Radhey Gupta). Samples were harvested from culture as described by Sapi et al. [1].

Materials and Methods

Treatment of pellets using Liberase TL

Liberase TL was used to release the organisms from any collagen that might be attached to the organism resulting from the harvesting process. Liberase TL was prepared using a stock solution of 2.5mg/mL, the equivalent of 13U/mL. 6µL of stock solution were added to 5mL PBS. This resulted in a final concentration of 2 U/mL in 1 X PBS which was added to the pellet in the tube and incubated for 4 min at 37 °C. Following the incubation period, 25µL of Proteinase K was added to the tube to stop the reaction. Tubes were stored at -20 °C until further use.

Removal of human DNA and RNA

Prior to extracting Borrelia DNA from the patient samples, human DNA was removed [8]. This method used Oxgall (5%) to rupture mammalian cells and micrococcal nuclease to inactivate mammalian DNA. Controls were performed to ensure that Borrelia DNA would remain intact during this process. Concentrations of Oxgall at 1%, 1.5%, 2%, 5%, and 10% in PBS were mixed with B. burgdorferi N40 at a concentration of 2.6 x 107 cells, incubated at 37 °C for 10 minutes, and densities were then read in a counting chamber.

To remove human DNA from patient samples harvested from blood culture [8], 200µL of the Liberase treated sample was mixed with 200µL 10% Oxgall (prepared in Type 1 autoclaved water) for a final concentration of Oxgall at 5%. The tubes were incubated at room temperature for 10 minutes, and then centrifuged at 13,000 rpm for 5 minutes and the supernatant discarded. The pellet was resuspended in100µL of 0.1µM CaCl2 and 5µL (103 gel units) micrococcal nuclease and incubated at 37 °C for 10 minutes. Following centrifugation at 13,000 rpm for 5 minutes, the pellet was resuspended in 200µL 1 X PBS and 10µL molecular grade Proteinase K was added. Incubation for 5 minutes at room temperature was performed to inactivate residual micrococcal nuclease before extracting the DNA.
Extraction of bacterial DNA using the MagJet Kit

DNA was extracted from samples using the MagJet Genomic DNA Kit (Cat. # K2721 Thermo Fisher Scientific, Life Technologies). This kit is designed for DNA extraction from bacteria, blood and tissues among other biological materials. Instructions were followed per the manufacturer.

Extraction of DNA using the Qiagen Kit
Bacterial DNA was also extracted using Cat # 51306 manufactured by Qiagen. This kit is designed to harvest both chromosomal and plasmid DNA from bacteria. The instructions supplied by the manufacturer were followed for this process.
Extraction of DNA using the MP Biomedical Fast Prep 24 semi-automated extractor
Tubes and processes for isolation of DNA from bacteria in soil samples were used as suggested by the manufacturer.
Harvesting time intervals
As designated in Table 3, harvesting from positive cultures was performed at various points in the life cycle of the culture. Harvest time points were 6 day positive and harvested at 6 days, 6 day positive and harvested at 8 weeks, eight week positive and harvested at 8 weeks.
PCR using OspC primers

Primers directed against the OspC gene were developed by Qiu et al. [7]. From this publication, primer designations OC6 F+ and OC602 R- were used. The master mix was prepared using 1-25ng of template, 20µM of each dNTP, PCR buffer, 1.5mM MgCl2 400 pM of each primer, 1.5 U of Taq, and 5% glycerol. The cycling conditions were 95 °C for 5min, 95 °C for 30sec, 50.5 °C for 30sec, 72 °C for 1min 30sec, repeat from step 2 for 39 times, and 72 °C for 5min and 4 °C keep. Two complete PCR cycles were run using the same primers. The size of the amplicon was 600 base pairs and amplicon size was confirmed by running a 2% agarose gel and using the 100 to 1000 bp ladder. Control DNA from B. burgdorferi B31 ATCC 35210 and E. coli ATCC 25922 were used with each run to validate the master mix conditions and cycling conditions.

PCR using B. burgdorferi plasmid gene primers

Primers directed against stable plasmids carried by B. burgdorferi were obtained from Dr Radhey S. Gupta, McMasters University, Hamilton, Ontario, Canada. These primers targeted the organism at the genus level. The forward primer was 5’-CTTGTCAAACTTATCAAATAGC-3’ and the reverse primer, 5’-AAATATGAATCATAAAAATCG-3’. Master mix was prepared using 1-25 ng of template, 20 µM of each dNTP, PCR buffer, 1.5mM MgCl2 400 pM of each primer, 1.5 U of Taq, and 5% glycerol. The cycling conditions were 95 °C for 5min, 95 °C for 30sec, 55 °C for 30sec, 72 °C for 1min 30sec, repeat from step 2 for 39 times, and 72 °C for 5 min and 4 °C keep. Two complete PCR cycles were run using the same primers. The size of the amplicon was 296 base pairs and amplicon size was confirmed by running a 2% agarose gel and using the 100 to 1000 bp ladder. Control DNA from B. burgdorferi B31 ATCC 35210 and E. coli ATCC 25922 were used with each run to validate the master mix conditions and cycling conditions.

PCR using LAMP 16S rRNA primers for B. burgdorferi

Ten LAMP primers were designed to target the DNA that codes for the16S rRNA region of Borrelia using Primer Explorer primer design software (Table 1). Reagents obtained from Lucigen for the LAMP reaction contain DNA polymerase, a reverse transcriptase enzyme, and strand displacement capabilities. This allows detection of either DNA or RNA targets. PCR master mix was prepared using these reagents (Table 2). A volume of 25µL per reaction tube was used. Each tube contained from 1-2µL of template with an effort to keep the concentration near 20ng, although concentrations ranging from 0.01ng to 100ng are acceptable. Reaction tubes were incubated at 65 °C for 25 minutes and the amplicons were immediately analyzed on an agarose gel. Control DNA from B. burgdorferi B31 ATCC 35210 and E. coli ATCC 25922 were used with each run to validate the master mix and cycling conditions. Amplicons were run on a 1.2% agarose gel using the 1 kb DNA ladder. Samples were prepared using 2µL of loading dye plus 18µL amplicon. Fifteen µL of this preparation was loaded onto the gel and run at 100 volts for 30 minutes (Figure 1).

 

LAMP

Plasmid

OspC

 

DNA extracted using Magjet

1

Pos

Neg

Pos

Day 6 positive Harvested Day 6 No Liberase treatment Human DNA not removed

2

Pos

Neg

Pos

6

Pos

Neg

Neg

7

Pos

Neg

Neg

8

Pos

Neg

Neg

10

Pos

Neg

Pos

DNA extracted using Magjet

13

Pos

Neg

Pos

Day 6 positive Harvested 8 weeks Treated with Liberase  Human DNA removed

14

Pos

Neg

Neg

15

Pos

Neg

Neg

16

Pos

Neg

Neg

17

Pos

Neg

Neg

18

Pos

Neg

Neg

DNA exttacted using Qiagen Kit 51306

23

Pos

Neg

Pos

Day 6 positive
Harvested Day 6
Liberase treated
Human DNA removed

25

Pos

Neg

Neg

26

Pos

Neg

Pos

27

Pos

Neg

Neg

28

Pos

Neg

Pos

57

Pos

Neg

Pos

DNA extracted using
MagJet

A

Neg

Neg

Neg

Day 6 positive Harvested Day 6 No Liberase treatment Human DNA removed Zeolite added

B

Neg

Neg

Neg

C

Neg

Neg

Pos

D

Neg

Neg

Neg

E

Neg

Neg

Neg

F

Neg

Neg

Neg

DNA extracted using
MP Biomedical Fast Prep
extractor

S51

Neg

Neg

ND

Day 6 positive Harvested Day 6 No Liberase treatment Human DNA not removed

S53

Neg

Neg

ND

S54

Neg

Neg

ND

S56

Neg

Neg

ND

S64

Neg

Neg

ND

MP Biomedical FastPrep 24 extractor

8ES28

Pos

ND

ND

8 wk pos, harvested 8 wk No Lib; Human removed

8ES45

Pos

ND

ND

DNA extracted using
MagJet

8MS1

Neg

Pos

Neg

8 wk positive
Harvested 8 weeks
No Liberase treatment
Human DNA removed

8MS2

Neg

Neg

Pos

8MS3

Neg

Neg

Pos

8MS4

Neg

Pos

Pos

8MS6

Neg

Pos

Neg

8MS7

Neg

Pos

Neg

8MS9

Neg

Neg

Pos

8MS12

Neg

Pos

Neg

8MS16

Neg

Pos

Neg

8MS22

Neg

Pos

Pos

8MS24

Neg

Pos

Neg

DNA extracted using
MagJet

8MS61

Pos

Neg

Neg

8 wk positive
Harvested 8 weeks
Liberase treated
Human DNA removed

8MS62

Pos

Neg

Neg

8MS64

Pos

Neg

Neg

8MS70

Pos

Neg

Neg

8MS73

Pos

Pos

Neg

 

 

25/47

9 of 45

14/40

 

 

 

53%

20%

35%

 

Table 1: PCR results using varied harvesting timepoints, pre-processing steps, DNA extraction methods and PCR primer configurations.

Name

Primer

nmol/OD

Position

Length

Tm

GC%

F3

GCTAATACCGAATAAGGTCAGT

3.9

148

22

60

41

B3

CGTCATCACTTTGTCATTTCC

4.9

472

21

60

43

FIP(F1c+F2)

TGTGACCGTTCACCCTCTCAGCGTCTTATTAGCTAGTTGGT

2.4

41

BIP(B1c+B2)

AGACTCCTACGGGAGGCAGTCTTCATTCACGCAGTGTC

2.5

38

LoopF

CGGTTACTTATCATTGCCTTGG

4.4

280

22

62

46

LoopB

CAGCTAAGAATCTTCCGCAATG

4.1

343

22

62

46

F2

GCGTCTTATTAGCTAGTTGGT

4.5

224

21

60

43

F1c

TGTGACCGTTCACCCTCTCA

5.1

303

20

65

55

B2

TCTTCATTCACGCAGTGTC

5.2

402

19

60

47

B1c

AGACTCCTACGGGAGGCAG

4.7

324

19

65

63

Table 2: LAMP designed primers used in the reaction mix.

Figure 1: Lane 1 is the kb DNA ladder, Lane 2 is empty, Lane 3-8 are patient samples, Lane 9 is empty, Lane 10 is B. burgdorferi B31 ATCC 35210 positive control, Lane 11 is empty, Lane 12 is E. coli ATCC 25922 negative control, Lane 13 is empty, and Lane 14 is water control.

Results

Figure 1 shows an example of the gel profile obtained when LAMP primers were used to amplify the DNA that codes for 16S rRNA of the Borrelia organism. The gel represents data from six patients plus a positive control, a negative control, and a water control. Gel patterns show multiple bands in a fixed configuration when positive results are obtained.

Results in Table 3 show that the LAMP PCR was positive in 53% of the positive samples. The conditions used included positive at 6 days and harvested at 6 days, positive at 6 days and harvested at 8 weeks, positive at 8 weeks and harvested at 8 weeks, DNA extraction using MagJet methodology (magnetic beads), DNA extraction using the Qiagen Kit Cat # 51306 (spin columns), Liberase TL treatment and human DNA removed, no Liberase treatment, no human DNA removed.

Component

Concentration

Nuclease-free water

to 25uL/tube

10X DNA Polymerase Buffer C

1X

dNTP's (25mM each)

800µM

100mM MgSO4

8mM

5M Betaine

0.5 M

Target-specific Primer Mix

Variable

OmniAmp DNA Polymerase, 50X

2X

Template

0.01ng - 100ng

Table 3: All reaction mix reagents were purchased from Lucigen in the OmniAmpTM RNA/DNA Kit and the reactions were set up using the concentrations.

In twenty-two of the samples, negative results were obtained using LAMP when human DNA was not removed and/or Liberase treatment was not applied. Six samples, however, did give positive results with LAMP when pre-processing was not performed.

Data extraction and analysis can be derived from Table 3. For example, positive signal comparisons at each collection time point are made in Figure 2. Considering all pre-processing steps collectively and all PCR methods, harvesting of 8 week positives at 8 weeks gave slightly more positives than either of the other two collection times. Collective positive results showed a positive rate in 6 day positives harvested at 6 days of 29%, a positive rate in 6 day positives harvested at 8 weeks of 39%, and a positive rate in 8 week positives harvested at 8 weeks of 42%.

Figure 2: Collective positive rates of samples harvested at three different time points. D6P, HD6=6 day positive, harvested at 6 days. D6P, H8W=6 day positive, harvested at 8 weeks. 8WP, H8W=8 week positive, harvested at 8 weeks.

In a breakdown of the differences based on extraction method, the following comparisons are made in Figure 3. In pellets treated with Liberase TL and with human DNA removed, the LAMP targeting DNA that codes for 16S rRNA out-performed both the plasmid primers and the OspC primers when DNA extractions were performed using either MagJet or Qiagen kits.

Figure 3: Comparison of LAMP 16S ribosomal PCR, plasmid PCR, and OspC PCR when DNA was extracted using either Magjet or Qiagen kit Cat #51306. These samples were treated with Liberase TL and had the human DNA removed.

Differences based on harvesting time points show additional relationships. LAMP primers performed substantially better (Figure 4) than either the plasmid primers or the OspC primers. The LAMP method showed a 100% positive rate at each harvest time point when samples were pre-treated with Liberase TL and processed to remove human DNA.

Figure 4: Comparison of three PCR procedures at three harvesting time-points. All samples were treated with Liberase TL and the human DNA was removed from the samples.

Discussion

LAMP technology was originally developed around the ability to perform PCR in the field or outside of a laboratory [9-14]. This has resulted in kits with workflow and simplicity advantages that can be performed outside of a biological hood on the bench in the clinical microbiology laboratory when pre-prepared lyophilized reagents are used. This application allows the addition of sample in buffer to a tube of lyophilized reagents, incubation at one temperature [15], and reads of turbidity or fluorescence using a simple instrument [16,17]. An additional advantage is that the nucleic acid in the sample does not have to be extracted or purified. LAMP primers are designed to amplify in a loop formation and then prime off the loops [18,19]. This serves as a way of generating considerably more product in considerably less time than conventional PCR [20].

To contrast the conventional PCR process with the LAMP process, LAMP can be performed in 30 min to 2 hours from sample to signal in a single tube at one temperature at low cost. Conventional PCR from sample to signal can take anywhere from one to two workdays even when using an automated nucleic acid extractor. It requires three separate rooms in the clinical laboratory, multiple tubes, complex preparation, a multiple temperature cycling instrument, and a means to detect the amplicons that are generated. For our application, two pre-processing steps, DNA extraction, two rounds of PCR in a thermo cycler, and a gel to visualize the signal was necessary when conventional PCR techniques were used. Not only does LAMP technology reduce the time for set up and signal generation, it allows the amplification of very small amounts of DNA in the sample and overcomes inhibiting substances that interfere with conventional PCR. Our data (Figure 3 and 4) clearly shows the ability of LAMP technology to out-perform conventional PCR.

The Lucigen OmniAmp reagents, designed specifically for LAMP amplification, contain specialized nucleic acid polymerases plus reverse transcriptase and allow for the amplification of DNA and RNA. In certain situations, especially viral amplification, this is a necessary added advantage [21]. A combination of LAMP primers has been used in multiplex reactions [22,23] and various approaches to designing the primers exist [24].

Considering the various time points and processes used to prepare DNA from blood culture for the PCR process, certain aspects can be observed. For example, for the majority of positive samples, two pre-processing steps and LAMP technology for amplification gave the best results. It is interesting to note that when using simple sense and antisense primers with two rounds of PCR, standard reagents and two pre-processing steps, inconsistent results were obtained. More consistent results were displayed when LAMP primers and Lucigen OmniAmp DNA and RNA reagents were used. Lucigen reagents contain both a DNA polymerase and a reverse transcriptase. Although DNA was used in these studies, future studies will take advantage of the fact that both RNA and DNA can be amplified during the detection process.

References

  1. Sapi E, Pabbati N, Datar A, Davies EM, Rattelle A, et al. (2013) Improved Culture Conditions for the Growth and Detection of Borrelia from Human Serum.Int J Med Sci10(4): 362-376.
  2. Picken MM, Picken RN, Han D, Cheng Y, Strle F (1996) Single-tube nested polymerase chain reaction assay based on Flagellin gene sequences for detection of Borrelia burgdorferi sensu lato. Eur J Clin Microbiol Infect Dis 15(6): 489-498.
  3. Strube C, Montenegro VM, Epe C, Eckelt E, Schnieder T (2010) Establishment of a minor groove binder probe based quantitative real time PCR to detect Borrelia burgdorferi sensu lato and differentiation of Borrelia spielmanii by Osp-A specific conventional PCR. Parasit Vectors 3: 69.
  4. Tveten AK (2013) Prevalence of Borrelia burgdorferi sensu stricto, Borelia afzelii, Borrelia garinii, and Borrelia valaisiana in Ixodes ricinus ticks from the northwest of Norway. Scand J Infect Dis 45(9): 681-687.
  5. Poon LL, Wong BW, Ma EH, Chan KH, Chow LM, et al. (2006) Sensitive and inexpensive molecular test for falciparum malaria: detecting Plasmodium falciparum DNA directly from heat-treated blood by loop-mediated isothermal amplification. Clin Chem 52(2): 303-306.
  6. Sen K, Ashbolt NK (2010) Environmental microbiology: current technology and water applications. Caister Academic Press, USA.
  7. Qiu WG, Dykhuizen DE, Acosta MS, Luft BJ (2002) Geographic uniformity of the Lyme disease spirochete (Borrelia burgdorferi)and its shared history with tick vector (Ixodes scapularis) in the Northeastern United States. Genetics 160(3): 833-849.
  8. Zhou L, Pollard AJ (2012) A Novel Method of selective removal of human DNA Improves PCR sensitivity for detection of Salmonella Typhiin blood samples. BMC infect Dis 12: 164.
  9. Chander Y, Koelbl J, Puckett J, Moser MJ, Klingele AJ, et al. (2014) A novel thermostable polymerase for RNA and DNA loop-mediated isothermal amplification (LAMP). Front Microbiol 5: 395.
  10. Georgie M (2009) Global health diagnostics: research, development and regulation. Academy of Medical Sciences Workshop Report, UK.
  11. Njiru ZK, Mikosza AS, Matovu E, Enyaru JC, Ouma J, et al. (2008) African trypanosomiasis: Sensitive and rapid detection of the sub-genus Trypanozoon by loop-mediated isothermal amplification (LAMP) of parasite DNA. Int J Parasitol 38(5): 589-599.
  12. Njiru ZK, Mikosza AS, Armstrong T, EnyaruJC, Ndung'u JM et al. (2008) Loop-Mediated Isothermal Amplification (LAMP) Method for Rapid Detection of Trypanosoma brucei rhodesiense. PLoS Negl Trop Dis 2(1): e147.
  13. Sattabongkot J, Tsuboi T, Han ET, Bantuchai S, Buates S (2014) Loop-mediated isothermal amplification (LAMP) for diagnosis of malaria infections in an endemic setting in Thailand. J Clin Microbiol 52(5): 1471-1477.
  14. http://www.google.co.in/patents/US6410278
  15. Geojith G, Dhanasekaran S, Chandran SP, Kenneth J (2011) Efficacy of loop mediated isothermal amplification (LAMP) assay for the laboratory identification of Mycobacterium tuberculosis isolates in a resource limited setting. J Microbiol Methods 84(1): 71-73.
  16. Mori Y, Kitao M, Tomita N, Notomi T (2004) Real-time turbidimetry of LAMP reaction for quantifying template DNA. J Biochem Biophys Methods 59(2): 145-157.
  17. Mori Y, Nagamine K, Tomita N, Notomi T (2001) Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Biophys Res Commun 289(1): 150-154.
  18. Nagamine K, Hase T, Notomi T (2002) Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes 16(3): 223-229.
  19. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, et al. (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28(12): E63.
  20. Francois P, Tangomo M, Hibbs J, Bonetti EJ, Boehme CC, et al. (2011) Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. FEMS Immunol Med Microbiol 62(1): 41-48.
  21. Curtis KA, Rudolph DL, Owen SM (2008) Rapid detection of HIV-1 by reverse-transcription, loop-mediated isothermal amplification (RT-LAMP). J Virol Methods 151(2): 264-270.
  22. Iseki H, Alhassan A, Ohta N, Thekisoe OM, Yokoyama N, et al. (2007) Development of a multiplex loop-mediated isothermal amplification (mLAMP) method for the simultaneous detection of bovine Babesia parasites. J Microbiol Methods 71(3): 281-287.
  23. Tanner NA, Zhang Y, Evans TC (2012) Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques 53(2): 81-89.
  24. Torres C, Vitalis EA, Baker BR, Gardner SN, Torres MW, et al. (2011) LAVA: an open-source approach to designing LAMP (loop-mediated isothermal amplification) DNA Signatures. BMC Bioinformatics 12: 240.
© 2014-2016 MedCrave Group, All rights reserved. No part of this content may be reproduced or transmitted in any form or by any means as per the standard guidelines of fair use.
Creative Commons License Open Access by MedCrave Group is licensed under a Creative Commons Attribution 4.0 International License.
Based on a work at http://medcraveonline.com
Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version | Opera |Privacy Policy