Journal of ISSN: 2373-6410JNSK

Neurology & Stroke
Research Article
Volume 4 Issue 2 - 2016
The Role of BDNF Gene Polymorphism in Formation of Clinical Characteristics of Migraine
Julia Azimova1,2, Natalia Kondratieva3, Alexey Sergeev2,4, Kirill Skorobogatykh2, Zarema Kokaeva3, Andrey Rachin1,2, Gyusal Tabeeva2,4 and Eugene Klimov3,5*
1Russian Scientific Center of Medical Rehabilitation and Balneology, Russia
2University Headache Clinic, Russia
3Department of Genetics, Faculty of Biology, Lomonosov Moscow State University, Russia
4Department of Neuroscience, Sechenov First Moscow State Medical University, Russia
5University diagnostic laboratory, Russia
Received:November 28, 2015 | Published: January 20, 2016
*Corresponding author: Eugene Klimov, Department of Genetics, Biological Faculty of Lomonosov Moscow State University, 119234, Moscow, Lenin Hills, 1-12, Russia, Email:
Citation: Azimova J, Kondratieva N, Sergeev A, Skorobogatykh K, Kokaeva Z, et al. (2016) The Role of BDNF Gene Polymorphism in Formation of Clinical Characteristics of Migraine. J Neurol Stroke 4(2): 00123. DOI: 10.15406/jnsk.2016.04.00123

Abstract

Objective: There is evidence that brain-derived neurotrophic factor (BDNF) has a role in migraine pathophysiology. In our research, association of substitutions in BDNF gene (rs6265, rs11030107, rs2049046) with clinical parameters of migraine is considered.

Background: Brain-derived neurotrophic factor (BDNF) is a neurotrophin presented widely in central nervous system. BDNF regulates axonal growth and differentiation; synapse formation; activity of dopaminergic, serotoninergic, GABA-ergic, and cholinergic neurons. Apparently, BDNF participates in the development of the primary forms of headaches.

Patients and Methods: The research included 155 patients with migraine (according to ICHD-III, 2013). The control group consisted in 203 unexamined individuals. Patients underwent clinical neurological examination and blood sampling. Genotypes were determined using PCR-RFLP method.

Results: We did not find a significant association between studied SNPs and migraine. We showed that the TT-genotype of rs2049046 influences the migraine chronification the episodes transform by regression of prodromal period, and the endurance of episodes themselves shortens. The GG genotype of rs6265 has no significant influence on the formation and manifestation of migraine. Possession of G-allele of rs1030107 influences the formation of drug abuse and higher frequency of photo- and phonophobia during the migraine episode.

Conclusions: Our results suggest that the substitutions rs2049046 and rs1030107 in BDNF gene play role in formation of clinical manifestations of migraine.

Keywords: Migraine; Clinical manifestations; Genetic association study; Brain-derived neurotrophic factor; Single nucleotide polymorphism

Abbreviations

BDNF: Brain-Derived Neurotrophic Factor; CGRP: Calcitonin Gene-Related Peptide (CALCA gene); TrkB: Tyrosine kinase Beta

Introduction

Brain-derived neurotrophic factor (BDNF) is a neurotrophin presented widely in central nervous system (CNS). The general function of BDNF in CNS is maintaining neuronal viability in ischemic condition, as well as providing neuronal plasticity and modulating behavioral activity. BDNF regulates axonal growth and differentiation of neurons; synapse formation; activity of dopaminergic, serotoninergic, GABA-ergic, and cholinergic neurons. BDNF also supports cognitive processes such as learning and memory. BDNF modulates both activating and inhibiting synapses affecting sodium channels and thus regulating neuronal excitability. Human BDNF gene is located in 11p14.1 region. It has 9 promoters and 11 exons. The sequence that encodes functional protein resides in the last exon. Alternative promoters provide 9 tissue- and time-specific transcripts that encode various leading peptides of pre-pro-protein BDNF [1,2]. The gene is expressed in nociceptive sensory neurons modulating metabotropic and ionotropic glutamate receptors. BDNF mRNA is translated into pre-pro-BDNF which is then processed into pro-BDNF and delivered to synapse. In the synapse, pro-BDNF is processed to form functional BDNF molecule. Targets of BDNF are tyrosine kinase receptors (TrkB). Activation of TrkB receptors triggers cascades that provide biological effects of BDNF (see Figure 1):

Figure 1: BDNF activated signaling pathways.
BDNF can interact with two receptors: NGFR (nerve growth factor receptor) and NTRK2 (neurotrophic tyrosine kinase, receptor, type 2). Both can activate PI3K (phosphatidylinositol 3-kinase) through activation of Ras (RAS oncogene homolog). PI3K activate AKT1 that play important role in neuron development. Also Ras through MAPKK (mitogen-activated protein kinase kinase or ERK activator kinases) activate MAPK (mitogen-activated protein kinase or ERK MAP kinases). The MAPK regulate activation of RPS6K (ribosomal protein S6 kinase) which phosphorylate CREB. Transcription factor CREB is a positive regulator of Egr/Krox (Egr transcription factors) transcription. Activation of CREB and Egr/Krox lead to expression of cytokines - important players in cell survival and in neuronal plasticity and neuron development too. NTRK2 also can activate PLC (phospholipase C) which produce InsP3. The last activate IP3R that lead to increase of intracellular calcium (Ca2+). Calcium leads to activation of CAMKK-CAMK regutation (calmodulin-dependent protein kinase kinases and calmodulin-dependent kinases, respectively) through interaction with calmodulin. Then CAMK phosphorylate and activate Egr/Krox and expression of cytokines. In another way Ca2+ can activate diacylglycerol kinase, which activate PKC (protein kinase C) - regulator of cell survival and neuronal plasticity - through diacylglycerol. InsP3: inositol 1,4,5–trisphospate; ER: endoplasmic reticulum. Designed in PathwayStudio 10.0 (Elsevier).
  1. Activation of protein kinases that support neuronal survival;
  2. Activation of RAS-dependent signaling pathway that supports growth and differentiation of neuronal cells;
  3. Activation of phospholipase C that indirectly stimulates expression of cytokines and Egr/Krox transcription factors.

The role of BDNF in the development of emotional affective disorders is the most studied one. For instance, major depression is accompanied with altered levels of BDNF and activity of TrkB receptors in key structures of “neuronal depression fields”: decrease of BDNF in prefrontal cortex and hippocampus, and increase of BDNF in the nucleus accumbens, amygdaloid complex, and ventral zone of operculum. The activity of TrkB receptors is increased in the prefrontal cortex and hippocampus, while no changes were found in nucleus accumbens. Oppositely, increased level of BDNF and high activity of TrkB receptors in the nucleus accumbens were registered in patients with addiction disorders [3]. Patients with major depression are characterized with lower level of BDNF in blood serum which correlates with severity of depression [4]. More, successful therapy with antidepressants is accompanied with decrease of BDNF level [5]. Six single-nucleotide polymorphisms were recorded in BDNF gene, which correlate with depression [6]. One of the most precisely studied substitutions is G/A transition in position 196 within exon 8 (rs6265) resulting in Val to Met substitution in codon 66 (5'-region of proBDNF) [7]. The substitution itself has no influence on BDNF protein but activity of BDNF-dependent secretion becomes suppressed. It is followed by abrupt changes in intracellular transfer and folding of proBDNF. It is proposed that this alteration may represent marker for resistant depression. However, such correlation was revealed only in Asiatic population during meta-analysis [8].

The role of brain neurotrophic factors in the development of chronic pain syndromes comorbid with depression is now under active investigation. The BDNF is proposed to be key substance which provides transmission of signal from glial cells to neurons. On one hand, BDNF activates neurons of I plate of posterior horn of spinal cord; this area is known to participate in pain transmission [9]. On the other hand, genotype GG of BDNF gene (rs6265) decreases the activity of brain neurotrophic factor. Absence of habituation after repeated pain stimuli was recorded in healthy individuals with GG genotype. It is possibly connected with anomalies of BDNF-mediated mechanisms of synaptic memory and plasticity or direct neurotransmitter effect of neurotrophin [10].

Studies on role of BDNF in development of primary forms of headaches are of special interest. Data on changes of BDNF content in serum of patients' blood are controversial. For example, decrease of BDNF in blood serum was reported for migraine (both with and without aura) and cluster headache [11]. In another case, the significant increase of BDNF content was found in plasma during migraine episode in comparison with period between episodes, and also between patients having tension headaches and healthy people [12]. As Sarchielli with coauthors reported that chronic migraine and other chronic pain syndromes (fibromyalgias) are associated with increase of BDNF content in cerebrospinal fluid [13]. In latest study lower levels of BDNF in plasma from patients with chronic migraine was shown [14]. The connection between primary headaches and BDNF is not random: the coexpression of brain neurotrophic factor and calcitonin gene-related peptide (CGRP, main pain transmitted for migraine) was described in transgeminal ganglion by Buldyrev et al. [15]. Is there any relation between BDNF gene polymorphism and migraine formation? No differences in frequencies of allele variants of rs6265 between healthy people and patients were found in research of Marziniak et al. [16]. No significant influence of genotype on clinical presentation was also recorded. However, Lemos and coauthors [17] studied changes in genes BDNF (rs7124442, rs6265, rs11030107, rs2049046) and CGRP (rs1553005) and obtained somewhat contradictory results. Patients with migraine were reported to have significantly higher frequency of G-allele in rs6265 and genotype AT in rs2049046, when comparing with healthy people. In addition, correlation was found between genotype TT in rs2049046 of BDNF and C-allele in rs1553005 of CGRP, which evidences for linkage of these genes. They are localized in contiguous loci (segments 11p14.1 and 11p15.2 for BDNF and CGRP, respectively). In 2014 Sutherland et al. [18] confirmed previous studies that the functional BDNF SNP rs6265 (Val66Met) is not associated with migraine. However, they found that rs2049046, which resides at the 5' end of one the BDNF transcripts, may be associated with migraine. The present study was aimed at influence of substitutions in BDNF (rs6265, rs11030107, and rs2049046) on development and clinical manifestation of migraine.

Materials and Methods

Patients

Totally 155 patients with migraine constituted the experimental group; all those patients applied to University Headache Clinic in 2013-2014 years. The age of patients comprised 41.6±12.5 years. 67.8% had episodic migraine, 32.2%- chronic migraine, 18.5%- migraine with aura. The control group consisted of 203 (healthy volunteers), living in the city of Moscow (without diagnosis of migraine or other type of headache). People of both groups were of similar age (from 18 to 57 years). Diagnosis of headache form was made in accordance with criteria of International Classification of Headache Disorders III-beta (2013) [19]. All the patients underwent a neurological interview and examination. Clinical information with regard to migraine characteristics was extracted from our database. Blood samples were collected by a qualified phlebologist. The research has been carried out in accordance with ethical standards laid down in the 1964 declaration of Helsinki and was approved by local ethics committee of Vavilov Institute of General Genetics Russian Academy of Science (Moscow). Written informed consent was obtained from all the participants.

Molecular genetics and statistical analysis

DNA was extracted according to protocol to commercial DNA MagnaTM DNA Prep 200 kit (Isogen Lab Ltd., Moscow, Russia). Genotypes were identified by PCR-RFLP method. The PCR was conducted according to protocol of commercial kit GenePakTM PCR Core (Isogen Lab Ltd., Moscow, Russia). Primers were synthesized by DNA Synthesis, LLC (Moscow, Russia). The restriction endonucleases produced by SibEnzyme Ltd. (Novosibirsk, Russia) were used for digestion; reactions were carried out in conditions recommended by producer. Primer sequences together with restriction endonucleases are listed in Table 1.

Substitution

Location in the gene

Sequence of primers

Restriction enzyme

RFLP product length, bp

rs6265
c.196G>A (p.Val66Met)

Exon 2

F: GAGGACAAGGTGGCTTGGCCTA
R: GGCCGAACTTTCTGGTCCTC

PspC I

AA=157; GG=116+41; AG=157+116+41

rs11030107
c.-21-14703T>C

Intron 1

F: CAGGTGGGGCTTTGTCTTTCAAG
R: GCATGTTCTCCCTTTAGGGACAT

Taq I

AA=118; GG=93+25; AG=118+93+25

rs2049046
c.-22+18416A>T

Intron 3

F: CAAAGTGTGACTTCAGATTGTCTG
R: AGAATAAGACAGCAGTACCGTACTT

Hinf I

AA=166+35; TT=198; AT=198+166+35

Table 1: Primer sequences and restriction endonuclease used in the work.

The analysis of allele frequencies and their association with migraine was conducted using χ2 method (Pearson's chi-square test) and using HaploView 4.2 software. Statistic processing of obtained results was conducted using parametrical (Student’s and Fisher’s tests) method with assistance of SPSS v17 software package.

Results

The allele and genotype frequencies we acquired are presented in Table 2. The distribution of genotype frequencies for rs6265 in studied groups (control: χ2=0.00, p=0.97; patients: χ2=2.26, p=0.13) and for rs11030107 in control group (χ2=0.01, p=0.92) corresponded to Hardy-Weinberg equilibrium. The deviation from Hardy-Weinberg equilibrium was observed for rs2049046 in distribution of genotype frequencies (control: χ2=11.73, p<0.001; patients: χ2=12.93, p<0.001) and for rs11030107 in patients (χ2=5.28, p=0.02).

Analysis using Pearson's chi-square test showed no association with migraine for all three SNPs (Table 2).

SNP

Genotype frequencies

Allele frequencies

rs6265

AA

AG

GG

A

G

patients

0.01

0.33

0.66

0.18

0.82

controls

0.02

0.24

0.74

0.14

0.86

χ2=4.29, p=0.12

χ2=2.45, p=0.12

rs11030107

AA

AG

GG

A

G

patients

0.67

0.33

0

0.83

0.17

controls

0.76

0.23

0.1

0.87

0.13

χ2=4.18, p=0.12

χ2=0.97, p=0.33

rs2049046

AA

AT

TT

A

T

patients

0.13

0.64

0.23

0.46

0.56

controls

0.14

0.58

0.28

0.43

0.57

χ2=1.82, p=0.40

χ2=0.27, p=0.60

Table 2: Frequencies of alleles and genotypes for studied genes and results of Pearson's chi-square test.
Notes: χ2– chi-square value, p-value – significance value. The number of degrees of freedom – 2; difference is not significant at p > 0.05.

We analyzed our experimental data using HaploView 4.2 software in order to reveal associations between studied SNPs and migraine. The results of this analysis are presented in Table 3.

Marker

Associated allele

Allele ratio; case, control

χ2

p-value

χ2 after permutation test

p-value after permutation test

rs2049046

A

134:164, 167:241

1.146

0.2843

1.146

0.8700

rs6265

G

239:59, 300:108

4.245

0.0394

4.245

0.1860

rs11030107

G

48:248, 23:127

0.058

0.8097

0.058

1.0000

Table 3: The associations between studied SNPs and migraine.
Notes: χ2 – chi-square value, p-value – significance value. The number of degrees of freedom – 1; difference is not significant at p > 0.05.

We did not find any significant difference in frequencies of studied alleles between patients and control group and therefore conclude that generally there is no association between studied SNPs and migraine. Association of allele G in rs6265 substitution in BDNF gene does not pass permutation test. We also analyzed the inheritance of studied SNPs (linkage disequilibrium test). High χ2 value of 5.365 (the number of degrees of freedom- 1, difference is significant at p=0.021, D’=0.28, LOD=0.94, R2=0.04) was observed only for the pair of polymorphic loci rs6265 and rs2049046. This allows us to reject the hypothesis of independent inheritance and conclude joint inheritance of the following allele combinations: rs6265-A/ rs2049046-A and rs6265-G/ rs2049046-T.

Meanwhile, the influence of studied substitutions on clinical parameter of the disease is of interest, as well. As distortions in regulation of BDNF content play the important role in development of emotionally-affected disorders, we also conducted the comparative analysis of frequencies of BDNF genotypes in groups with episodic and chronic migraine (Table 4). As seen from this table, GG-variant of rs6265 substitution possibly contributes into development of chronic migraine, also being discussed as factor of depression pathogenesis.

Genotype

Episodic migraine %

Chronic migraine %

Ñ€-value

rs2049046

 

АА

11.1

10.9

0.9

АТ

81.1

65.2

0.04

ТТ

7.8

23.9

0.008

rs6265

 

AA

2.3

0

0.2

AG

31.4

32.6

0.8

GG

66.2

67.4

0.9

rs11030107

 

AA

70.4

62.2

0.3

AG

29.6

33.3

0.6

GG

0

4.4

0.06

Table 4: rs6265, rs11030107 and rs2049046 genotypes of patients with chronic and episodic migraine.

To evaluate influences of substitutions in BDNF gene on manifestation of symptoms, we also performed comparative analysis of different allele variants. As frequencies of AA-genotype of rs2049046, AA-genotype of rs6265 and GG-genotype of rs11030107 were low enough, these genotypes were analyzed together with heterozygotes (Table 5). Our data evidence for fact that the TT-genotype of polymorphism rs2049046 influences the migraine chronification the episodes transform by regression of prodromal period, and the endurance of episodes themselves shortens. Additionally, patients with TT-genotype are significantly more often characterized with sickness which regresses to a lesser degree during migraine transformation. The GG genotype of rs6265 has no significant influence on formation and manifestation of migraine. Possession of G-allele of rs1030107 influences the formation of drug abuse. For example, abuse of analgesics (especially codeine-containing) is more often observed among carriers of G-allele, and the drug abuse is expressed significantly stronger. Except this, patients bearing G-allele in rs11030107 are characterized with higher frequency of photo- and phonophobia during migraine episode.

Symptom

rs2049046

rs6265

rs11030107

TT

AA+AT

p

GG

AA+AG

p

AA

AG+GG

p

Representation of chronic migraine, %

70.3

38.8

0.008

36.0

34.1

0.9

32.9

42.9

0.3

Representation of drug abuse, %

44.4

31.1

0.3

36.4

31.1

0.6

29.4

45.3

0.04

Number of single doses of analgesics per month

42.6±65.7

31.3±57.9

0.5

31.5±53.7

38.1±70.6

0.6

30.4±55.8

41.0±70.2

0.04

Abuse of codeine-containing drugs, %

35.7

34.4

0.9

34.3

39.4

0.6

28.6

48.2

0.04

Age of migraine manifestation

17.5±10.2 years

18.1±8.7 years

0.8

18.8±9.7 years

16.6±6.7 years

0.2

18.2±8.6 years

17.4±9.7 years

0.7

Duration of disease

24.8±12.2 years

23.4±12.6 years

0.7

23.3±12.4 years

23.5±13.2 years

0.9

24.0±12.3 years

21.1±12.5 years

0.3

Positive hereditary history for migraine, %

57.2

73.4

0.2

68.0

75.6

0.4

73.1

62.9

0.3

Presence of aura, %

26.7

17.4

0.4

17.9

19.1

0.9

21.7

13.5

0.3

Presence of prodrome, %

13.3

38.3

0.05

36.1

31.6

0.6

36.8

35.7

0.9

Presence of postdrome, %

14.3

31.6

0.1

23.9

39.5

0.09

27.8

37.0

0.4

Number of migraine days per month

12.1±8.1

8.1±9.8

0.1

9.3±10.5

7.7±9.1

0.4

8.3±9.6

9.7±10.9

0.5

Duration of migraine attack

19.3±12.8 hours

37.8±27.6 hours

0.02

35.1±28.4 hours

35.6±25.4 hours

0.9

37.9±28.9 hours

29.0±21.3 hours

0.07

Pain intensity

8.1±1.3 VAS points

8.3±1.5 VAS points

0.5

8.3±1.6 VAS points

8.4±1.3 VAS points

0.9

8.3±1.5 VAS points

8.4±1.6 VAS points

0.2

Throbbing pain, %

78.6

77.7

0.9

75.3

81.0

0.5

79.0

77.8

0.9

Allodynia during episode, %

38.5

47.6

0.5

41.1

56.1

0.2

44.7

50.0

0.6

Time of most intensive pain achievement

76.6±58.3 minutes

98.3±81.1 minutes

0.4

92/5±74.5 minutes

103.3±86.8 minutes

0.5

99.4±84.6 minutes

82.1±48.4 minutes

0.2

Recurrent headache, %

20.0

43.1

0.2

43.1

40.0

0.7

38.3

45.5

0.6

Sickness, %

100

89.3

0.001

90.1

92.9

0.6

91.4

80.1

0.4

Vomiting, %

26.7

50.0

0.09

45.6

52.4

0.5

45.7

50.0

0.7

Photophobia, %

86.7

85.1

0.9

86.4

83.3

0.7

82.7

94.4

0.02

Phonophobia, %

86.7

83.9

0.9

86.4

81.0

0.4

82.7

94.4

0.02

Osmophobia, %

42.9

54.1

0.4

50.6

52.4

0.9

52.5

54.3

0.9

Table 5: The features and specter of migraine symptoms in patients with different genotypes.
Table Abbreviations: VAS: Visual Analogue Scale.

Discussion

The present investigation demonstrated that the SNPs rs6265, rs2049046 and rs11030107 in BDNF gene are not associated with migraine in the sample studied by us. No such correlation was found and in work of Marziniak et al. [16]. It is possibly connected with specificity of samples of patients. In our investigation, we used DNA from patients of specialized medical center for headaches; the third part of them had chronic migraine, drug abuse, and depression. However, TT genotype of rs2049046 appeared to be more important for development of chronic migraine. It was also found out that carriers of G-allele of rs11030107 are more predisposed to heavy drug abuse and often consume with codeine-containing drugs.

Polymorphism of BDNF gene may underlie comorbidity between migraine and emotionally-affected disorders (especially depression), this phenomenon being demonstrated in large-scale studies [20]. It is proposed that succession of stress events leads to decrease of content of brain neurotrophic factor as a result of increase of activity of hypothalamo-pituitary-adrenal axis [21]. TrkB receptors are widely distributed in serotoninergic neurons of raphe nucleus [3], the structure responsible for both depression development and chronic headache. The BDNF was proved to move from hippocampus to raphe nucleus via retrograde transport [22], thus activating serotoninergic neurons. Moreover, BDNF possesses direst antidepressant effect [23] and mediates an action of selective inhibitors of serotonin reuptake [3]. It might be that normally pain stimulus leads to secretion of calcitonin gene-related peptide which in its turn causes increase of BDNF level. The latter activates central antinociceptive systems, which is sanogenetic mechanism. The malfunction of BDNF in patients with migraine (e.g., in case of mutation in rs6265) defect of central antinociceptive systems arises in response to pain impulsation and CGRP secretion, which was confirmed in study of trigeminal induced potentials by Di Lorenzo with colleagues [24].

The role of BDNF in development of addictions and drug abuse is also of significant interest. For example, use of prohibited psychostimulant agents (cocaine, amphetamines) leads to increase of BDNF level. Morphine injection inhibits BDNF synthesis in ventral area of operculum, but after cessation of opiates' injections synthesis of BDNF reactivates [3]. The BDNF content is increased also in addictions which do not deal with drugs e.g. in case of gambling [25]. The rs6265 substitution is also a risk factor for nicotine addiction and more severe alcoholic addiction [3]. The amino acid substitution Val66Met (and subsequent decrease in intensity of BDNF synthesis) is also typical for anomalies of food behavior [26]. We demonstrated interrelation between substitution in r11030107 in BDNF gene and development of drug abuse (primarily codeine-containing drugs) in patients with migraine.

Conclusion

Hence, brain neutrotrophic factor modulates numerous physiological functions in the scentral neural system and may participate in different stages of migraine pathogenesis. The genetically determined BDNF deficiency may lead to malfunction of activation of central analgesic actions in response to nociceptive stimulation as one of the mechanisms underlying migraine chronification. Besides, polymorphisms in BDNF gene may serve as common reasons for development of both migraine and associated depression, as well as of drug abuse phenomenon.

Acknowledgement

The authors thank the subjects for their participation in this research study. We thank Paul Golovatenko-Abramov for help with manuscript preparation and Taisiya Kochetkova for help with genetic analysis. This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

Author’s Contributions

Conception: Julia Azimova, Eugene Klimov, Andrey Rachin, Gyusal Tabeeva
Clinical support: Julia Azimova, Alexey Sergeev, Kirill Skorobogatykh
Molecular genetic analysis: Natalia Kondratieva, Zarema Kokaeva, Eugene Klimov
Statistical analysis: Julia Azimova, Eugene Klimov, Natalia Kondratieva
Manuscript Preparation: Julia Azimova, Eugene Klimov
Writing of the first draft: Julia Azimova, Eugene Klimov

References

  1. Pruunsild P, Kazantseva A, Aid T, Palm K, Timmusk T (2007) Dissecting the human BDNF locus: bidirectional transcription, complex splicing, and multiple promoters. Genomics 90(3): 397-406.
  2. Shugart YY, Chen L, Day IN, Lewis SJ, Timpson NJ, et al. (2009) Two British women studies replicated the association between the Val66Met polymorphism in the brain-derived neurotrophic factor (BDNF) and BMI. Eur J Hum Genet 17(8): 1050-1055.
  3. Autry AE, Monteggia LM (2012) Brain-derived neurotrophic factor and neuropsychiatric disorders. Pharmacol Rev 64(2): 238-258.
  4. Karege F, Bondolfi G, Gervasoni N, Schwald M, Aubry JM, et al. (2005) Low brain-derived neurotrophic factor (BDNF) levels in serum of depressed patients probably results from lowered platelet BDNF release unrelated to platelet reactivity. Biol psychiatry 57(9): 1068-1072.
  5. Piccinni A, Marazziti D, Catena M, Domenici L, Del Debbio A, et al. (2008) Plasma and serum brain-derived neurotrophic factor (BDNF) in depressed patients during 1 year of antidepressant treatments. J Affect Disord 105(1-3): 279-283.
  6. Licinio J, Dong C, Wong ML (2009) Novel sequence variations in the brain-derived neurotrophic factor gene and association with major depression and antidepressant treatment response. Arch Gen Psychiatry 66(5): 488-497.
  7. Sanchez MM, Das D, Taylor JL, Noda A, Yesavage JA, et al. (2011) BDNF polymorphism predicts the rate of decline in skilled task performance and hippocampal volume in healthy individuals. Transl Psychiatry 1: e51.
  8. Zou YF, Ye DQ, Feng XL, Su H, Pan FM, Liao FF (2010) Meta-analysis of BDNF Val66Met polymorphism association with treatment response in patients with major depressive disorder. Eur Neuropsychopharmacol 20(8): 535-544.
  9. Trang T, Beggs S, Salter MW (2011) Brain-derived neurotrophic factor from microglia: a molecular substrate for neuropathic pain. Neuron Glia Biol 7(1): 99-108.
  10. Gomez-Palacio-Schjetnan A, Escobar ML (2013) Neurotrophins and synaptic plasticity. Curr Top Behav Neurosci 15: 117-136.
  11. Blandini F, Rinaldi L, Tassorelli C, Sances G, Motta M, et al. (2006) Peripheral levels of BDNF and NGF in primary headaches. Cephalalgia 26(2): 136-142.
  12. Fischer M, Wille G, Klien S, Shanib H, Holle D, et al. (2012) Brain-derived neurotrophic factor in primary headaches. J Headache Pain 13(6): 469-475.
  13. Sarchielli P, Mancini ML, Floridi A, Coppola F, Rossi C, et al. (2007) Increased levels of neurotrophins are not specific for chronic migraine: evidence from primary fibromyalgia syndrome. J Pain 8(9): 737-745.
  14. Martins LB, Duarte H, Ferreira AV, Rocha NP, Teixeira AL, et al. (2015) Migraine is associated with altered levels of neurotrophins. Neurosci Lett 587: 6-10.
  15. Buldyrev I, Tanner NM, Hsieh HY, Dodd EG, Nguyen LT, et al. (2006) Calcitonin gene-related peptide enhances release of native brain-derived neurotrophic factor from trigeminal ganglion neurons. J Neurochem 99(5): 1338-1350.
  16. Marziniak M, Herzog AL, Mossner R, Sommer C (2008) Investigation of the functional brain-derived neurotrophic factor gene variant Val66MET in migraine. J Neural Transm (Vienna) 115(9): 1321-1325.
  17. Lemos C, Mendonca D, Pereira-Monteiro J, Barros J, Sequeiros J, et al. (2010) BDNF and CGRP interaction: implications in migraine susceptibility. Cephalalgia 30(11): 1375-1382.
  18. Sutherland HG, Maher BH, Rodriguez-Acevedo AJ, Haupt LM, Griffiths LR (2014) Investigation of brain-derived neurotrophic factor (BDNF) gene variants in migraine. Headache 54(7): 1184-1193.
  19. Headache Classification Subcommittee of the International Headache Society (2004) The International Classification of Headache Disorders. 2nd edition. Cephalalgia 24(Suppl 1): 9-160.
  20. Breslau N, Davis GC (1992) Migraine and psychiatric disorders: a prospective epidemiologic study. Clin Neuropharmacol 15(Suppl 1 Pt A): 279A-280A.
  21. Duman RS, Heninger GR, Nestler EJ (1997) A molecular and cellular theory of depression. Arch Gen Psychiatry 54(7): 597-606.
  22. Anderson KD, Alderson RF, Altar CA, DiStefano PS, Corcoran TL, et al. (1995) Differential distribution of exogenous BDNF, NGF, and NT-3 in the brain corresponds to the relative abundance and distribution of high-affinity and low-affinity neurotrophin receptors. J Comp Neurol 357(2): 296-317.
  23. Hu Y, Russek SJ (2008) BDNF and the diseased nervous system: a delicate balance between adaptive and pathological processes of gene regulation. J Neurochem 105(1): 1-17.
  24. Di Lorenzo C, Di Lorenzo G, Daverio A, Pasqualetti P, Coppola G, et al. (2012) The Val66Met polymorphism of the BDNF gene influences trigeminal pain-related evoked responses. J Pain 13(9): 866-873.
  25. Geisel O, Banas R, Schneider M, Hellweg R, Muller CA (2013) Serum levels of brain-derived neurotrophic factor in patients with internet use disorder. Psychiatry res 209(3): 525-528.
  26. Ribases M, Gratacos M, Armengol L, de Cid R, Badia A, et al. (2003) Met66 in the brain-derived neurotrophic factor (BDNF) precursor is associated with anorexia nervosa restrictive type. Mol Psychiatry 8(8): 745-751.
© 2014-2016 MedCrave Group, All rights reserved. No part of this content may be reproduced or transmitted in any form or by any means as per the standard guidelines of fair use.
Creative Commons License Open Access by MedCrave Group is licensed under a Creative Commons Attribution 4.0 International License.
Based on a work at http://medcraveonline.com
Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version | Opera |Privacy Policy