Journal of ISSN: 2373-437XJMEN

Microbiology & Experimentation
Research Article
Volume 3 Issue 2 - 2016
NDM-Producing Enterobacteriaceae Strains among Hospitals in Brasília, Brazil
Celio Faria-Junior1*, Lilian de Oliveira Rodrigues1, James Oki de Carvalho1, Octavio Luiz Franco2, Alex Leite Pereira3* and Brasília Study Group on Bacterial Resistance
1Núcleo de Bacteriologia, Laboratório Central de Saúde Pública do Distrito Federal, Brazil
2Centro de Análises Proteômicas e Bioquímicas, Universidade Católica de Brasília, Brazil
3Faculdade de Ceilândia, Universidade de Brasília, Brazil
Received: September 13, 2015 | Published: January 29, 2016
*Corresponding author: Celio de Faria Junior, Núcleo de Bacteriologia, Laboratório Central de Saúde Pública do Distrito Federal, SGAN quadra 601, lotes O/P, Asa Norte, CEP: 70830-010, Brasília, Brazil, Tel.: +55-61-3321-0774; , Alex Leite Pereira, Campus de Ceilândia, Universidade de Brasília, Brasília-DF, Brazil, Email:
Citation: Faria-Junior C, Rodrigues LDO, Carvalho JOD, Franco OL, Pereira AL, et al. (2015) NDM-Producing Enterobacteriaceae Strains among Hospitals in Brasília, Brazil. J Microbiol Exp 3(2): 00083.DOI: 10.15406/jmen.2016.03.00083

Abstract

Carbapenem-resistant Enterobacteriaceae (CRE) strains have spread worldwide frequently driven by clonal spread. Additionally, plasmid-borne carbapenemase genes (blaKPC and blaNDM) have broadened the variability of species expressing resistance to carbapenems. This study aimed to characterize the susceptibility profile and bla genes in CRE strains recovered between 2012 and early 2014 in hospitals in Brasília, Brazil. Eighty eight CRE strains recovered from 19 medical settings were analyzed. Klebsiella pneumoniae positive for blaKPC accounted for the most of the CRE isolates (n=47; 53.4%). Seven blaNDM-positive strains (including K. pneumonia, n=4; Proteus mirabilis, n=1; Escherichia coli, n=1; and Providencia rettgeri, n=1) were recovered from patients in six hospitals. The first detected blaNDM-1-positive strain was P. rettigeri. Thereafter, blaNDM-1-positive K. pneumoniae strains showing indistinguishable Random Amplified Polymorphic DNA (RAPD) profiles were recovered in three hospitals. The susceptibility profile of blaNDM-1–positive K. pneumoniae strains was commonly restricted to amikacin, aztreonam and tigecycline. These dates highlighted the emergence of blaNDM-1–positive K. pneumonia strains marked by a single RAPD type among hospitals in Brasília, Brazil.

Keywords: NDM-producing strains; Carbapenemase; Klebsiella pneumonia; Metallo-β-lactamase

Introduction

The resistance to carbapenems has become a serious world public health issue since the early 2000’s [1]. In that time, the world spread of Klebsiella pneumoniae carbapenemase (KPC)-producing strains was supported by the predominance of a well-adapted clone of K. pneumoniae (ST258) among hospitals around the world. Moreover, the blaKPC gene became easily mobilized by conjugative plasmids among Enterobacteria species [2]. NDM-1 (New Delhi metallo-β-lactamase-1) is the most recently discovered molecular class B β-lactamase encoded on transferable, plasmid-borne genes (blaNDM) [3]. The hydrolysis mechanism of NDM relies on the interactions between β-lactam molecules and zinc ions in the enzyme’s active site. Therefore, NDM enzymes are inhibited by zinc-chelating agents such as EDTA [4]. NDM can hydrolyze all β-lactam antibiotics (penicillins, cephalosporins and carbapenems), excepting monobactams [3]. Additionally, most NDM-positive strains are broadly resistant to other antibiotic classes, and carry a wide diversity of resistance mechanisms against other antibiotics, such as aminoglycosides and fluoroquinolones, rendering these strains extremely resistant to the available treatments [1]. NDM-1 was first described in K. pneumoniae and Escherichia coli strains isolated in Sweden in 2008 from an Indian patient who had been transferred from a hospital in New Delhi, India [5]. Nowadays, NDM has also been detected in a broad variety of other Enterobacteriaceae species including K. oxytoca, Proteus mirabilis, Enterobacter cloacae, Citrobacter freundii and Providencia spp as well as in aerobic bacilli such as Pseudomonas spp. and Stenotrophomonas spp. [3]. This wide distribution of the blaNDM gene reflects its association with promiscuous plasmids [6]. Regardless the purposes, whether medical or otherwise, international travels have played a significant role in the dissemination of NDM producers, given that, most of the first reports on NDM-positive strains were epidemiologically linked to travels to Indian and Pakistani regions [7]. In Brazil, the first NDM-producing strain was isolated in 2013 in the South region state, Rio Grande do Sul [8]. Beside blaKPC and blaNDM, other carbapenemase genes, such as blaVIM, blaIMP and blaOXA-48, have been reported in Enterobacteria world-wide, including in Brazil. However, these carbapenemase genes have not been associated with large spreads or epidemic events [9].

The aim of this study was to define the profile of carbapenemase genes in CRE strains assessing whether NDM-producing strains have reached hospitals in Brasília, the federal capital of Brazil. Moreover, the study evaluated the role of bacterial clones in spreading of blaNDM among hospital.

Materials and Methods

From 2012 to 2014, a regional surveillance program was conducted by the Public Health Laboratory (LACEN-DF) in order to assess carbapenem resistance in Enterobacteriaceae isolates recovered from hospitals in Brasília. We have identified 88 carbapenem-resistant Enterobacteriaceae (CRE) strains recovered from patients attended in nineteen medical centers. Identification and antimicrobial susceptibility tests were accomplished using the MicroScan WalkAway™ system (Dade Behring, USA) and Vitek MS system (Matrix-assisted laser desorption ionization-time of flight mass spectrometry - MALDI-TOF MS system - BioMerieux) in accordance to the manufacturer’s instructions. In order to assess the clinical susceptibility of bacterial isolates, in vitro antibiogram test results were interpreted in accordance to the breakpoints established by the Clinical and Laboratory Standards Institute (CLSI) document published in January 2014. The production of carbapenemase was tested using the modified Hodge Test (MHT) employing ertapenem disk adsorbed with 10µg of the antibiotic as described by CLSI [10]. Metallo-β-lactamase production was tested with carbapenem-containing disks (10µg meropenem or imipenem) adsorbed with 100mM EDTA [11]. Control disks containing only carbapenem were used to evaluate the enlargement of inhibitory zones attributed to the EDTA effect. Specific primers were used in standard polymerase chain reactions (PCR) to detect the following carbapenemase genes: blaKPC (F, 5`TGTCACTGTATCGCCGTC and R, 5`CTCAGTGCTCTACAGAAAACC) [12], blaNDM (F, 5`GGTTTGGCGATCTGGTTTTC and R, 5`GGCCTTGCTGTCCTTGATC), blaIMP (F1, CATTTCCATAGCGACAGCAC; F2, 5`AACACGGTTTGGTGGTTCTT and R, 5`GGACTTTGGCCAAGCTTCTA), blaVIM (F, 5`GATGGTGTTTGGTCGCATATC and R, 5`CTCGATGAGAGTCCTTCTAGAG) and blaOXA-48 (F, 5`GCGTGGTTAAGGATGAACAC and R, 5`ATCATCAAGTTCAACCCAACC). The primers used for amplification of blaNDM, blaIMP, blaVIM and blaOXA-48 were described in this study. PCR products were submitted to DNA sequencing (ABI 3130 Genetic Analyzer- Applied Biosystems®) in order to confirm the identity of the amplified genes. Clonal relatedness among isolates was examined by Random Amplified Polymorphic DNA (RAPD) performed with the primer OPA-2 (5’TGCCGAGCTG) (Operon Technologies, Alameda, CA, USA) [13]. The band patterns were analyzed by visual interpretation, applying the criteria established by Belkum et al. [14]. In addition, RAPD patterns were analyzed and dendograms were built employing PyElph software system (version 2.6.5) [15].

Results and Discussion

Among Enterotacteriaceae strains reported to the Public Health Laboratory (LACEN-DF) in Brazil, K. pneumonia was the most frequently CRE detected (n=61/88; 69.3%), followed by species of Enterobacter (n=15/88; 17.1%).

The emergence of CRE species has increased the demand on old or outdated antibiotics [16]. In this scenario, the increasing interest on colistin (polymyxin) as an evaluable treatment has driven the emergence of species intrinsically resistant to colistin including Proteuss spp., Serratia spp., Morganella spp. and Providencia spp. [17] In our study, intrinsically colistin-resistant strains accounted for 9.0% of the CRE isolates and they included S. marcescens (n=4/88; 4.5%), P. mirabilis (n=3/88; 3.4%) and P. rettgeri (n=1/88; 1.1%).

In relation to carbapenemase genes, blaKPC was the most frequently detected gene in the tested CRE strains (n=59/88; 67.0%), followed by blaNDM (n=7/88; 8.0%). Additionally, carbapenemase genes with minor epidemiological relevance were also tested (blaVIM, blaIMP and blaOXA-48), but they were not detected among the CRE isolates. Focusing on NDM genes, we firstly isolated a blaNDM-positive P. rettgeri strain from a necrotic ulcer affecting a 75-year-old male patient in May 2013. The patient had received treatment in two hospitals, both located in Brasília, and had not reported travelling abroad in the six previous years. The P. rettgeri strain showed in vitro resistance to all tested antimicrobial agents with the exception of gentamicin. The sequence analysis (Basic Local Alignment Search Tool) of the blaNDM amplicon showed an identity of 100% (435/435 base-pairs) with previous reported blaNDM-1 genes (GeneBank Number: KJ150691.1). Additionally, two distinct bands of plasmid DNA were found in the P. rettgeri strain (data not shown). PCR assays carried out with purified plasmid DNA showed that blaNDM-1 gene was located on the high-molecular-weight plasmid (molecular weight >50 Kb). Interesting, Carvalho-Assef et al. [8] also recovered a NDM-producing P. rettgeri strain from a diabetic foot infection in early 2013, but differently the blaNDM-1 gene was chromosomally integrated.

Thereafter the first detection of blaNDM, six other blaNDM-positive strains (K. pneumonia, n=4; P. mirabilis, n=1; E. coli, n=1) were isolated in three hospitals. All isolates were resistant to β-lactams (with exception of aztreonam and cefotetan), quinolones, nitrofurantoin and trimethoprim-sulfamethoxazole; and showed variable susceptibility profiles against aminoglycosides, tetracycline and tigecycline (Table 1). Interesting, all NDM-producing strains showed negative results for the carbapenemase expression assay MHT. However, NDM-producing strains are positive in the EDTA test confirming the production of metallo-β-lactamases (Table 1). Negative or weakly positive results in MHT have been already reported for NDM-producing strains [18]. However, these findings are worrisome once phenotypic detection of carbapenemase in MHT is recommended for the clinical microbiology laboratories as epidemiological screening assay for detection of CRE isolates [10].

Patient

Species

Susceptible phenotypea

Hospitals

Isolation Date

Assays for carbapenemase detection

Phenotypic assay for carbapenemase
(MHT)

Phenotypic assay for metallo-β-lactamase (EDTA test)

PCR for blaNDM

1

Providencia rettgeri

GEN, TET

A

03/06/2013

Negative

Positive

Positive

2

Klebsiella pneumoniae

AMI, AZT, TET, TGN

B

20/08/2013

Negative

Positive

Positive

3

Klebsiella pneumoniae

AMI, TGN

B

07/09/2013

Negative

Positive

Positive

4

Proteus mirabilis

AMI, CTE, GEN, TOB,

B

30/10/2013

Negative

Positive

Positive

5

Klebsiella pneumoniae

AMI, TGN

C

3/11/2013

Negative

Positive

Positive

6

Klebsiella pneumoniae

AMI, AZT, TET, TGN

D

11/11/2013

Negative

Positive

Positive

6

Escherichia coli

AMI, AZT, GEN, NIT, TGN

E

21/01/2014

Negative

Positive

Positive

Table 1: NDM-producing strains isolated in Brasília hospitals.
aAbbreviations: AMI, amikacin; GEN, gentamicin; TOB, tobramycin; TET, Tetracycline; TGN, Tigecycline; AZT, Aztreonam; CTE, Cefotetan.

Four strains of NDM-producing K. pneumoniae were isolated from patients treated in three hospitals; therefore, it was tested if these strains were clonally unrelated as commonly reported for blaNDM-positive strains [19-21]. However, all NDM-producing K. pneumoniae strains tested in this study were considered as genetically indistinguishable on RAPD analyses, showing the same amplified polymorphic DNA pattern (Figure 1B & 1C). Two of these strains were isolated from two patients (patients 2 and 3) assisted in the same hospital (hospital B), warning for the possibility of cross infections (Table 1 & Figure 1). The other two clonal strains of K. pneumoniae were isolated from two patients (patients 5 and 6) treated in two different hospitals (hospital C and D) (Table 1 & Figure 1). Moreover, because of a prolonged colonization period (2 months and 10 days) with blaNDM-positive strains (K. pneumoniae and E. coli), the patient 6 had the opportunity of translocating two NDM-producing enterobacterial species into two different hospitals (Table 1). Additionally, the isolation of different bacterial species positive for blaNDM from the patient 6 (Table 1) endorses the idea on the promiscuous nature of mobile genetic elements carrying blaNDM genes [3]. These findings reinforce the role of patient transfer in spreading NDM-producing bacteria among hospitals [22], and endorses the need of rapid communication that alerts about the presence of infected or colonized patients with NDM-producing strains in Brazil hospitals.

Figure 1: Distribution of cases of NDM-producing Enterobacteriaceae strains in Brasília and genetic relatedness of blaNDM-producing K. pneumoniae strains. A) Geographic distribution of the occurrence of NDM-producing strains. Symbols: Stars correspond to the cases associated with blaNDM-positive K. pneumoniae (small star - 1 case; large star - 2 cases). Circles indicate cases associated with other blaNDM-positive strains (Providencia rettgeri, P. mirabilis and Escherichia coli). B) RAPD profiles of the carbapenem-resitant K. pneumoniae strains. blaNDM-positive K. pneumoniae showed the same RAPD profile (samples 8-11) and were named KPBSB clone. Sample 1, K. pneumoniae IOC4955; sample 2, K. pneumoniae ATCC700603; samples 3 to 7 and 12 blaKPC-positive strains isolated in different hospitals in Brasília (enrolled to examine the discriminatory power of the RAPD assay); samples 8 and 9, blaNDM-positive strains isolated in hospital B; sample 10, blaNDM-positive strain isolated in hospital D; and, sample 11, blaNDM-positive strain isolated in hospital C. C) Dendrogram of the RAPD profiles as analyzed with PyElph software system (version 2.6.5). (see description of figure 1B for sample consultation).

As occurs in Brasília, Brazilian hospitals have frequently reported outbreaks involving CRE strains mainly associated with blaKPC-positive K. pneumoniae strains belonging to the clonal complex 258 (ST 11) [23,24]. The clone ST11 of K. pneumoniae has been characterized for causing large outbreaks [25], and has been also responsible for spreading blaNDM gene in Greece [26]. Taken together, these data warn about the possibility of a worst-case scenario, in which, the epidemic clone ST11 would acquire the blaNDM gene and spread among Brazilian hospital.

Conclusion

Hospitals in Brazil have reported the isolation of several species of CRE positive for blaKPC, and, more recently, for blaNDM as well. Additionally, the initial spread of blaNDM-positive K. pneumoniae strains has been driven by a single clone. Our findings suggest that blaNDM-positive strains are been transported among hospitals by inpatient transfers and that they are spreading throughout patient cross infections. Finally, the present results call for an improved surveillance on inpatient transfers, for the molecular detection of CRE strains, and for enforcements in infection control measures.

Conflict of Interest

All authors declare to have no conflict of interest.

Acknowledgement

Brasília Study Group on Bacterial Resistance: Alessandra Peres Pinheiro Domingues, Alessandra Reis Moreira, Brenda Paula Pires-Sousa, Eli Mendes Ferreira, Leonardo Borges Ferreira, Luana A A Martins, Melissa Jordão Sacramento, Michelle Capucci Martins. This work was supported by Fundação de Apoio à Pesquisa do Distrito Federal (Grant numbers: 193.000.019/2012, 2010/00188-1, 563981/2010-5), Conselho Nacional de Desenvolvimento Científico e Tecnológico (Grant number 301156/2011-5) and Coordenação de Aperfeiçoamento de Nível Superior (Grant number 001-2009).

References

  1. Nordmann P, Dortet L, Poirel L (2012) Carbapenem resistance in Enterobacteriaceae: here is the storm! Trends Mol Med 18(5): 263-272.
  2. Nordmann P, Cuzon G, Naas T (2009) The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis 9(4): 228-236.
  3. Nordmann P, Poirel L, Walsh TR, Livermore DM (2011) The emerging NDM carbapenemases. Trends Microbiol 19(12): 588-595.
  4. Queenan AM, Bush K (2007) Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev 20(3): 440-458.
  5. Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, et al. (2009) Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother 53(12): 5046-5054.
  6. Walsh TR, Weeks J, Livermore DM, Toleman MA (2011) Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis 11(5): 355-362.
  7. Johnson AP, Woodford N (2013) Global spread of antibiotic resistance: the example of New Delhi metallo-β-lactamase (NDM)-mediated carbapenem resistance. J Med Microbiol 62(Pt 4): 499-513.
  8. Carvalho-Assef AP, Pereira PS, Albano RM, Berião GC, Chagas TP, et al. (2013) Isolation of NDM-producing Providencia rettgeri in Brazil. J Antimicrob Chemother 68(12): 2956-2957.
  9. Bonelli RR, Moreira BM, Picão RC (2014) Antimicrobial resistance among Enterobacteriaceae in South America: history, current dissemination status and associated socioeconomic factors. Drug Resist Updat 17(1-2): 24-36.
  10. CLSI (2014) Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fourth Informational Supplement n.d.:CLSI document M100-S24. Clinical and La, Wayne, PA, USA.
  11. Nordmann P, Poirel L, Carrër A, Toleman MA, Walsh TR (2011) How to detect NDM-1 producers. J Clin Microbiol 49(2): 718-721.
  12. Yigit H, Queenan AM, Anderson GJ, Domenech-Sanchez A, Biddle JW, et al. (2001) Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother 45(4): 1151-1161.
  13. Abou-Dobara MI, Deyab MA, Elsawy EM, Mohamed HH (2010) Antibiotic susceptibility and genotype patterns of Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa isolated from urinary tract infected patients. Polish J Microbiol 59(3): 207-212.
  14. van Belkum A, Tassios PT, Dijkshoorn L, Haeggman S, Cookson B, et al. (2007) Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin Microbiol Infect 13(Suppl 3): 1-46.
  15. Pavel AB, Vasile CI (2012) PyElph - a software tool for gel images analysis and phylogenetics. BMC Bioinformatics 13: 9.
  16. Kanj SS, Kanafani ZA (2011) Current Concepts in Antimicrobial Therapy Against Resistant Gram-Negative Organisms: Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae, Carbapenem-Resistant Enterobacteriaceae, and Multidrug-Resistant Pseudomonas aeruginosa. Mayo Clin Proc 86(3): 250-259.
  17. Kontopidou F, Plachouras D, Papadomichelakis E, Koukos G, Galani I, et al. (2011) Colonization and infection by colistin-resistant Gram-negative bacteria in a cohort of critically ill patients. Clin Microbiol Infect 17(11): E9-E11.
  18. Castanheira M, Deshpande LM, Mathai D, Bell JM, Jones RN, et al. (2011) Early dissemination of NDM-1- and OXA-181-producing Enterobacteriaceae in Indian hospitals: report from the SENTRY Antimicrobial Surveillance Program, 2006-2007. Antimicrob Agents Chemother 55(3): 1274-1278.
  19. Nordmann P, Naas T, Poirel L (2011) Global spread of Carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis 17(10): 1791-1798.
  20. Nordmann P, Poirel L, Toleman MA, Walsh TR (2011) Does broad-spectrum beta-lactam resistance due to NDM-1 herald the end of the antibiotic era for treatment of infections caused by Gram-negative bacteria? J Antimicrob Chemother 66(4): 689-692.
  21. Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, et al. (2010) Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis 10(9): 597-602.
  22. van der Bij AK, Pitout JDD (2012) The role of international travel in the worldwide spread of multiresistant Enterobacteriaceae. J Antimicrob Chemother 67(9): 2090-2100.
  23. Pereira PS, de Araujo CF, Seki LM, Zahner V, Carvalho-Assef AP, et al. (2013) Update of the molecular epidemiology of KPC-2-producing Klebsiella pneumoniae in Brazil: spread of clonal complex 11 (ST11, ST437 and ST340). J Antimicrob Chemother 68(2): 312-316.
  24. Nicoletti AG, Fehlberg LC, Picao RC, Machado Ade O, Gales AC (2012) Clonal Complex 258, the Most Frequently Found Multilocus Sequence Type Complex in KPC-2-Producing Klebsiella pneumoniae Isolated in Brazilian Hospitals. Antimicrob Agents Chemother 56(8): 4563-4564.
  25. Chmelnitsky I, Shklyar M, Hermesh O, Navon-Venezia S, Edgar R, et al. (2013) Unique genes identified in the epidemic extremely drug-resistant KPC-producing Klebsiella pneumoniae sequence type 258. J Antimicrob Chemother 68(1): 74-83.
  26. Voulgari E, Gartzonika C, Vrioni G, Politi L, Priavali E, et al. (2014) The Balkan region: NDM-1-producing Klebsiella pneumoniae ST11 clonal strain causing outbreaks in Greece. J Antimicrob Chemother 69(8): 2091-2097.
© 2014-2016 MedCrave Group, All rights reserved. No part of this content may be reproduced or transmitted in any form or by any means as per the standard guidelines of fair use.
Creative Commons License Open Access by MedCrave Group is licensed under a Creative Commons Attribution 4.0 International License.
Based on a work at http://medcraveonline.com
Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version | Opera |Privacy Policy