Journal of ISSN: 2373-4469JIG

Investigative Genomics
Research Article
Volume 4 Issue 1 - 2017
Isolation, Cloning and Sequencing of Poly 3-Hydroxybutyrate Synthesis Genes from Local Strain of Bacillus cereus mm7 and Expressing them in E. coli
Haddad A El Rabey1*, Mona O Albureikan2, Magda M Aly2,3, Saleh A Kabli2, Katja Schneider4 and Greta Nölke4
1Bioinformatics Department, Sadat City University, Sadat City, Egypt
2Biology Department, King Abdulaziz University, Saudi Arabia
3Botany Department, Kafrelsheikh University, Egypt
4IME, Fraunhofer Institute, Germany
Received: November 09, 2016 | Published: January 26, 2017
*Corresponding author: Haddad A El Rabey, Bioinformatics Department, Genetic Engineering and Biotechnology Institute, Sadat City University, Sadat City, Minufiya, Egypt, Email:
Citation: El Rabey HA, Albureikan MO, Aly MM, Kabli AS, Schneider K, et al. (2017) Isolation, Cloning and Sequencing of Poly 3-Hydroxybutyrate Synthesis Genes from Local Strain of Bacillus cereus mm7 and Expressing them in E. coli. J Investig Genomics 4(1): 00056. DOI: 10.15406/jig.2017.04.00056

Abstract

Poly 3-hydroxybutyrate (PHB) is the most known degradable biopolymers, produced by some genera of bacteria under unfavorable growth conditions. Isolation, cloning, and expression of PHB genes from PHB producing Bacillus cereus was achieved. A highest Poly 3-hydroxybutyrate producer bacterium was selected and identified as Bacillus cereus MM7, based on morphological and physiological characters in addition to 16S rRNA gene sequences. The four genes of Bacillus cereus MM7 that involved in Poly 3-hydroxybutyrate production were successfully amplified using specific primers which were designed depending on the sequence alignment of the known PHA biosynthetic genes from Bacillus cereus, cloned in E. coli DH5α and completely sequenced. Moreover, the expression of the four genes responsible for PHA biosynthetic in E. coli XL1-Blue and E coli MJ 109 was assayed by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis. In the current study Bacillus cereus was able to synthesize PHB. PHB genes were isolated, cloned and expressed in E. coli DH5α. The PHB encoding proteins were analyzed in SDS-PAGE and the PHB corresponding protein bands were analyzed using mass spectrometry to nominate their amino acid sequence.

Keywords: Bioplastic; Bacillus; PHB; Gene; Cloning; Expression; Polyacrylamide

Introduction

Poly 3-hydroxybutyrate (PHB) is a polyhydroxyalkanoate (PHA) which is a polymer belonging to the polyesters class that are of interest as bio-derived and biodegradable plastics produced by some genera of bacteria under unfavorable conditions [1].

PHA can be accumulated by microorganisms in the environment naturally or PHA can be produced artificially by microorganisms if they are fed with specific chemicals in the laboratory which are not the normal substrates for cell growth and survival [2]. It is the only bioplastics completely synthesized by over 30 % of soil bacteria [3].

PHA synthases are divided into four groups i.e. I- II- III and IV, based on the enzymes substrate specificities and the enzymes subunit composition [4]. The three classes I (found in Ralstonia eutroPHA), III (found in Allochromatium vinosum), and IV (found in Bacillus megaterium) PHA synthases have substrate specificities toward short-chain-length monomers (C3-C5), whereas class II (found in Pseudomonas aeruginosa) PHA synthase utilizes medium-chain-length monomers (C6-C14) [5].

Excess carbon sources with limitation of nitrogen and phosPHAte were used to produce PHB in different kinds of bacteria [6,7]. Furthermore, Ghate et al. [8] isolated different Bacillus species for the production of polyhydroxybutyrate (PHB) from soil samples. Sangkharak et al. [9] isolated twenty five Bacillus sp. strains that were able to accumulate polyhydroxyalkanoates (PHAs).

Davis et al. [10] used new pathway employing genes for b-ketothiolase and NADPH dependent acetoacetyl CoA reductase (PHAA and PHAB) isolated from Bacillus sp. 256 and genes for PHA synthase and (R)-specific enoyl CoA hydratase (PHAC1 and PHAJ1) cloned from P. aeruginosa for the production of PHB in recombinant E. coli. PHA biosynthetic genes from different species were cloned for mass production of PHAs for commercial use [6,11-13]. Tomizawa et al. [14] studied the expression of PHA synthases from Bacillus megaterium NBRC15308 (PHARCBm), B. cereus YB-4 (PHARCYB4) and hybrids (PHARBmCYB4 and PHARYB4CBm) in Escherichia coli JM109 to characterize the molecular weight of the synthesized poly (3-hydroxybutyrate) [P (3HB)].

The aim of the current study was the selection and identification of the most active PHB producing bacteria, isolating the PHB genes, cloning and sequencing them and assaying the expression of PHB genes in Escherichia coli. The PHB encoding proteins were analyzed in SDS-PAGE and the PHB corresponding protein bands were analyzed using mass spectrometry to nominate their amino acid sequence.

Materials and Methods

A highly PHB producing isolate was isolated in our lab from sea water sample collected from North Beach of Jeddah, Saudi Arabia and identified as Bacillus cereus MM7 based on morphological and physiological characters in addition to 16S rRNA gene sequences [15]. This bacterium was used as a source for PHB genes.

Pre culture

The pre culture was prepared in 250 ml Erlenmeyer flasks containing 50 ml of nutrient broth [16]. Each flask was inoculated with a loop of the tested cultures and incubated in a 130 rpm speed rotary shaker at 30ËšC for 24h.

Isolation of genomic DNA

The DNA of PHB producing strain was extracted using Nucleo Spin Tissue Kit (Macheri Nagal, Germany) according to the manufacturer’s instruction.

Colony PCR

For colony PCR amplification, bacterial colonies were picked using a sterile tooth pick and dipped into 10µl of water plus 10µl PCR reaction mixture consisting of 0.4µl of forward and 0.4µl reverse primers, 0.5µl dNTPs, 2 µl PCR buffer, 0.6µl MgCl2, 0.3µl Taq DNA polymerase and 5.8 µl. Amplification reaction was performed using MWG-Biotech Primus 96 thermocycler, Galileo Equipos S.L, Spain) under the following reaction conditions; initial denaturation at 95ËšC for 5 min, followed by 25 cycles denaturation at 94ËšC for 1m, annealing at 55ËšC for 1m and elongation at 74ËšC for 3 min and final elongation at 72ËšC for 10 min.

Recombinant E. coli medium

The medium used for E. coli growth was LB medium (5 g yeast extract, 10 g tryptone, 10 g NaCl per liter of deionized water). For PHB production, it was supplemented with 20 g/L glucose in a 500-ml shaking flask containing 100-ml medium at 37ËšC for 24h. Sterilized ampicillin was added to the E. coli culture medium to a final concentration of 100μg/ml.

PCR amplification of the PHA genes

The isolated DNA from B. cereus MM7 strain was used as a template for PCR amplification of PHA biosynthesis genes which contain (PHAA, PHAR, PHAB and PHAC). The oligonucleotide primers for PCR amplification are listed in Table 1. The primer of PHAA gene was designed based on the sequence alignment of the known PHA synthases from the B. cereus group (organisms B. cereus, accession number EU239690) [10], while the oligonucleotide primers for PCR amplification of PHAR, PHAB and PHAC were designed in this study based on the sequence alignment of the known PHA synthases from B. cereus. (Accession number AB525763) [17].

Strains/ Plasmid / Primers

Relevant Description

Source or
Reference

E. coli DH5α

Cloning strain

Biolab.

E. coli XL1-Blue

Expression strain

promega

E. coli JM109

Expression strain

promega

pJET1.2/blunt cloning vector

linearized with Eco32I (EcoRV) (GenBank/EMBL Accession number EF694056), and has the highest efficiency cloning of PCR products

Thermo Scientific CloneJET PCR Cloning Kit.

Fw pJET1.2 5’-d(CGACTCACTATAGGGAGAGCGGC)-3’

pJET1.2 primers

From Thermo Scientific Fermentas™ pJET™1.2

Rv pJET1.2 5’-d(AAGAACATCGATTTTCCATGGCAG)-3’

Fw (1) PHAA 5-TACGTAACTAATAACGAGGGGAG-3

Amplification of PHAA gene of Bacillus cereus for cloning it into pJET

Designed at
Fraunhofer
Institute,
Aachen

Rv (1) PHAA 5-GCTTCCAACGCCCTCCTGTTCTAAACG-3

Fw (2) PHAA 5-CTAATAACGAGGGGAGATATCGTTC-3

Rv (2) PHAA 5-GTCGTTTCACCCCTTCCTGTGAGGC-3

Fw (1) PHARBC operon 5-AAATATAGACTTGAAGTTTTATTCAG-3

Amplification of PHARBC genes of Bacillus cereus for cloning it into pJET

At
Fraunhofer
Institute,
Aachen

Rv (1) PHARBC operon 5-AACATAGGCTAGTTGGATTTTTTAT-3

Fw (2) PHARBC operon 5-GACTTGAAGTTTTATTCAGAATATTAG-3

Rv (2) PHARBC operon 5-CATAAAAAAATCCAACTAACATAGGC-3

Fw PHARBC operon: 5- GCGCTTGTTTATAACATATGAAAG-3

Amplification to detection of B gene of Bacillus cereus

Designed at
Fraunhofer
Institute,
Aachen

Rv PHARBC operon: 5-CTATCTCCTTTTTGGTCAATTTC-3

Fw PHAA 5-ATTAATAATGCGGCCGCCATGAGAGAAGCTGTCATTG-3

Amplified PHAA gene for subcloning it into pJET-PHARBC(+)

Designed at
Fraunhofer
Institute,
Aachen

Rv PHAA 5-ATTAATAATCTCGAGTTATAGTAATTCAAATACTCCCG-3

Table 1: E. coli strains, plasmid and primers used in this study.

PCR amplification protocol for PHAA, PHAB, PHAC and PHAR

PCR reactions were achieved using genomic DNA as a template in 25µl PCR reaction mixture consisted of 2.5 µl PCR buffer, 0.5µl of each forward and reverse primers, 0.5µl dNTPs, 0.5µl polymex enzymes, 1µl DNA (containing 50-100 ng DNA) and 19.5µl water. PCR reaction condition was as follows: under the following reaction conditions; initial denaturation at 95ËšC for 5 min, followed by 25 cycles denaturation at 94ËšC for 1m, annealing at 55ËšC for 1m and elongation at 74ËšC for 3 min and final elongation at 72ËšC for 10 min. The PCR product was excised using clean scalper under UV light, purified using NucleoSpin® Gel and PCR Clean-up kit (Macheri Nagal, Germany) and then sequenced (at DNA sequencing unit at Fraunhofer Institute for Molecular Biology and Applied Ecology, Germany).

The PCR product was resolved on 0.8% or 1.2% agarose gel (w/v agarose in 1X TBE) buffer depending on the size of DNA and the experiment. The running buffer was 1X TBE buffer. The gel was stained with 0.1μg ml ethidium bromide, visualized under UV light, and then photographed using gel documentation system.

Ligation of PHAA PCR product to pJET-PHARBC

The ligation was performed according to the instruction of ligation protocol supplied with T4 DNA ligase (New England Biolabs).

Bacterial transformation of DH5α, E. coli XL1-blue and E. coli JM109

Heat-shock transformation was performed in DH5α, E. coli XL1-Blue and E. coli JM109 according to the instruction of Lamitina Lab Protocols.

Cloning of PHA synthase genes from the strain Bacillus cereus MM 7

All E. coli strains, plasmid and primers are listed in Table 1. The purified PCR product was ligated to the pJET1.2/blunt cloning vector (Clone JET PCR Cloning Kit, Fermentas, Thermo Fisher Scientific Inc) according to the instructions of the supplier to get three kinds of plasmids; pJET-PHAA (Figure 1A), pJET-PHARBC (Figure 1B) and pJET-PHAARBC (Figure 1C). After plasmid was extracted using miniprep Kit (Nucleo Spin Plasmid kit, Macheri Nagal, Germany). All the three types of plasmids were transformed separately into E. coli DH5α using heat shock transformation protocol according to Lamitina Lab protocols. Afterwards, the plasmid was extracted and the concentration of plasmid was measured and digested with XhoI (Biolabs, England) to check the size after cutting with restriction enzyme and check if there is other site can be cut. Oligonucleotide primers containing NotI and XhoI restriction sites sequences were designed by Biolabs for PCR amplification of PHAA gene in pJET +PHAA. After that, the PCR product of PHAA and (+) pJET +PHARBC were digested with (NotI and XhoI), and then PHARBC and PHAA were ligated to each other and to the pJET vector according to the ligation protocol of T4 DNA ligase protocol (M0202), (New England Biolabs) to get (+) pJET +PHAARBC operon (Figure 1C). The construct was transformed into E. coli DH5α, E. coli XL1-Blue and E. coli MJ 109. The (+) pJET +PHAARBC operon was sequenced at (Fraunhofer Institute for Molecular Biology and Applied Ecology, Germany).

Figure 1A: pJET –PHAA plasmid.
Figure 1B: The (+) and (-) pJET -PHARBC operon plasmid.
Figure 1C: The (+) and (-) pJET -PHAARBC operon plasmid.

Determination of the (+) orientation for pJET +PHARBC operon and (+ pJET+PHAARBC using HindIII restriction enzyme

The PHARBC operon was then digested with HindIII to determine the orientation, if it is (+) or (-) before ligation and also to determine the orientation for PHAARBC if it is (+) or (-). The samples were resolved on agarose gel, and then estimated the bands size to know the kind of orientation.

Determination of the (+) orientation for pJET +PHARBC operon and (+) pJE+PHAARBC by colony PCR

To determine the orientation of pJET +PHARBC operon, if it is (+) or (-), colony PCR amplification was achieved using forward B gene detection primer and forward pJET1.2 primer (which must give no band in the gel with only (+) orientation for pJET +PHARBC operon). Also, it was done using forward B gene detection primer and the reverse pJET1.2 primer (which must give band in the gel with only (+) orientation for pJET +PHARBC operon). After detecting the positive colony was incubated in 5 ml LB medium and the plasmid was isolated and its concentration was measured using Nano drop spectrophotometer. PCR was run using the same primers that was used in colony PCR to assure results. On the other hand, to check the orientation for pJET +PHAARBC if it is (+) or (-) after ligation, forward pJET1.2 primer and reverse PHAA gene primer were used for amplification (It must give band in the gel with (+) orientation). Then the positive colony was inoculated in 5 ml LB medium and the plasmid was isolated and its concentration was measured using Nano drop spectrophotometer. PCR amplification was achieved using the same primers listed in Table 1 and the same PCR reaction conditions mentioned above.

PHB genes expression

The gene expression of PHB genes was achieved according to McCool et al. [18]. After getting the (+) pJET - PHAARBC operon construct, it was transformed to E. coli DH5α, E. coli XL1-Blue and E. coli MJ 109, and then grown overnight.

The transformed strains were grown at 37ËšC in Luria Bertani medium alone and also in Luria Bertani medium supplemented with glucose. The crude extracts of E. coli strains were prepared after 7h and 24h of incubated by sonication. Then, spun for 5 min at 11000 rpm. The crude extracts of E. coli strains were precipitated and soluble proteins (supernatant) were separated from insoluble proteins (pellet). Then, proteins were loaded on SDS-PAGE 12% (w/v) polyacrylamide gel and run at 35mA for 1hour.

All the expected protein bands of PHB genes expression (PHAA 41,13 KD: PHAB 26.54KD: PHAC 41.69KD: PHAR 18.5KD ) were excised from the SDS-gel and analyzed using mass spectrometry (Mascot software. Matrix science) at the proteins analyses unit in Fraunhofer Institute for Molecular Biology and Applied Ecology, Germany. The amino acid sequence of all PHB genes was compared to that present in the databases using BLAST search to find the most homologous sequences to them.

Results

PCR amplification of the PHB genes

The genomic DNA of PHA producing bacteria (Bacillus cereus MM7) was used as a template for PCR amplification of the PHA biosynthesis genes which consists of PHAA, PHAR, PHAB and PHAC. Two of the oligonucleotide primers for PCR amplification of PHAA gene gave positive result with clear bands in the gel while the other two primers did not give bands. Also, the oligonucleotide primers for PCR amplification of PHAR, PHAB and PHAC operon gave positive result with clear bands in the gel, whereas the other two primers did not give any band. PCR reaction resulted in a successful amplification of an approximately 900 bp (for partial fragment) and distinct 1.8 kb (for full-length gene) from the tested bacteria as shown in Figure 2.

Cloning of PHA synthesis genes from the strain Bacillus cereus MM7

 After PCR product purification to PHAA and PHAR, PHAB, PHAC operon and cloning them into the pJET1.2/blunt cloning vector, three recombinant plasmids (pJET-PHAA, pJET-PHARBC operon and pJET-control) were obtained. These plasmids were successfully transformed separately into E. coli DH5α by using heat shock transformation. Then, again the plasmid was extracted and digested with XhoI to check the size after cutting with restriction enzyme and check if there is another sites can be cut and the results showed that the size of pJET-PHAA (4221pb) and for pJET-PHARBC operon (5809pb) were correct as expected and it was also appeared that only one restriction site in the plasmid was there, which mean that all the four genes PHAA and PHAR, PHAB, PHAC operon were successfully cloned in two pJET1.2/blunt cloning vectors (Figure 3). Then, the PHAA gene in pJET +PHAA was amplified and digested with restriction enzymes NotI and XhoI before running the digestion product in the gel to check the size of PHAA gene (1179pb) (Figure 4). The (+) pJET +PHARBC operon with NotI and XhoI was digested and successfully ligated to get (+) pJET +PHAARBC operon which transformed to E. coli DH5α, E. coli XL1-Blue and E. coli MJ 109.

Detecting if the pJET+PHAA was successfully ligated to pJET+PHARBC operon

The forward primer pJET1.2 and the reverse primer PHAA were used to detect the orientation of pJET +PHAARBC, whether it is (+) or (-). The PCR result showed a band which means that pJET +PHAARBC was (+) orientation (Figure 5).

The sequence data of PHAA

The sequence data of PHAA was 1186 bp as shown in the Supplementary Figure 1. The BLAST search of this sequence showed 99% homology to the sequence of acetyl-CoA acetyltransferase from Bacillus thuringiensis BMB171, accession No. (NC_014171.1), [19] and Bacillus cereus ATCC 14579, accession No.: NC_004722.1 [20].

The sequence data of PHAB

The sequence data of PHAB fragment is 745 bp as shown in the Supplementary Figure 2 and the BLAST search showed 98% homology to acetoacetyl-CoA reductase of Bacillus thuringiensis serovar finitimus YBT-020 NC_017200.1 [21] and Bacillus thuringiensis serovar finitimus YBT-020 NC_017200.1 [21] and Bacillus cereus FRI-35, accession No.: NC_018491.1.

Figure 2: Amplification of PHAA and PHARBC genes from Bacillus cereus MM7. M: 1 Kb DNA ladder. Lane 2 and 3: Amplification of B. cereus PHAA region using primers TAC+GCT. Lane 6 and 7: Amplification of PHARBC operon from B. cereus using primers AAA+ AAC. Line 4+5 (C-): PCR negative control: PCR mix without B. cereus genomic DNA. DNA1, DNA2: duplicate preparations of genomic DNA.

The sequence data of PHAC

The sequence data of PHAC is 1086 bp as given in the Supplementary Figure 3 and the BLAST search showed 98% homology to poly(R)-hydroxyalkanoic acid synthase subunit PHAC from Bacillus thuringiensis serovar finitimus YBT-020, accession No. NC_017200.1 [21].

Figure 3: Determination of the size of PHAA and PHARBC by digestion with XhoIrestriction enzyme. M: 1 Kb DNA ladder. Lane 1, Lane 2 and Lane 3 are PHAA plasmid from different colonies. One expected fragment 4221 bp. Lane 3, lane 4 and lane 5 are PHARBC operon plasmid from different colonies. One expected fragment 5809 bp.

The sequence data of PHAR

The sequence data of PHAR is 484 bp as given in Supplementary Figure 4 and also aligned sequence ata of PHAR using BALAST search, showed 99% homology to PHA synthase subunit PHAR; regulator of PHAP of Bacillus cereus ATCC 10987, accession No.: NC_003909.8 [22].

Figure 4: Amplification of PHAA gene, PHAA gene was sub cloned into (+) pJET-PHARBC operon and the amplification product was cut by NotI and XhoI enzymes.

The complete sequence of the PHA operon

The complete sequence of the PHA operon is 4279 bp as shown in Supplementary Figure 5. The BLAST search gave 98% homology to PHAR protein acetoacetyl-CoA reductase of Bacillus cereus ATCC 14579, accession No. NC_004722.1 [20].

Figure 5: Detecting of the correct ligation of PHAA with pJET - PHARBC by colony PCR. In this experiment, the inserted gene PHAA was tested if it is correctly ligated to pJET -PHARBC operon using colony PCR (using fw vec. + rv PHAA). Many colonies were amplified which means that the inserted gene PHAA is ligated correctly with pJET -PHARBC operon.

PHA synthase gene expression

All the expected protein bands in the SDS-gel (PHAA 41,13 KD: PHAB 26.54KD: PHAC 41.69KD: PHAR 18.5KD ) were cut and the proteins were analyzed using mass spectrometry (Mascot software, Matrix science) at the proteins analyses unit in Fraunhofer Institute for Molecular Biology and Applied Ecology, Germany. The result confirmed the presence of PHAA, PHAR and PHAB, which means that PHAA, PHAR and PHAB are expressed. But there was no clear protein band in the gel for PHAC which means that PHAC is probably expressed with very little amounts or not expressed. Also, the current results showed that using the proteins pellet better than soluble proteins in SDS-PAGE gel for expression analysis (Figure 6).

Figure 6: A. M: Protein marker. Lane 1: Wild type of E. coli JM109. Lane 2 control. Lane3 PHAA Lane 4 PHARBC. Lane 5: All PHAARBC. Using Pellet 1.5 ml. B .M: Protein marker. Lane 1: Wild type of E. coli JM109. Lane 2 control. Lane3 PHAA Lane4 PHARBC. Lane 5: All PHAARBC.

Moreover, the proteins were expressed clearly when using medium not supplemented with glucose better than using medium supplemented with glucose (Figure 7). The proteins bands were clearer when the strains were incubated for 24 h than 7 h as shown in Figure 8.

PHA expression

Figure 7: A. M: Protein marker. Lane 1: control of E. coli JM109. Lane2 PHAA, Lane 3 PHARBC. Lane 4: All PHAARBC. Using pellet 1.5 ml (L.B with glucose). Lane5 PHAA, lane 6 PHARBC. Lane 7: PHAARBC. Loaded without glucose. B. M: Protein marker. Lane 1: control of E. coli XL1- Blue. Lane2 PHAA, lane 3 PHARBC. Lane 4: All PHAARBC. Using pellet 1.5 ml. (L.B with glucose). Lane5 PHABCR lane 6. PHAARBC. Loading was done without glucose.
Figure 8: A. M: Protein marker. Lane 1: control of E. coli JM109. Lane2 PHAA, Lane 3 PHARBC. Lane 4: All PHAARBC. Using Pellet 1.5 ml. 24 h (15 µl). B. M: Protein marker. Lane 1: control of E. coli JM109. Lane2 PHAA, lane 3 PHARBC. Lane 4: All PHAARBC, using pellet 1.5 ml. 7 h (15 µl).

The expression of PHA genes in E. coli (transformed with PHA genes), showed the production of three protein subunits, PHAA, PHAB, PHAR and the absence of PHAC protein subunit. The MS analysis of the three proteins showed that PHA was 390 amino acids as shown in the supplementary materials figure 6, PHAB was 247 amino acids (Supplementary Figure 7) and the PHR was 176 amino acids (Supplementary Figure 8). On the other hand, the BLASTP search of the amino acid sequence for PHAA subunit. The PHAA amino acid sequence showed 100% homology to acetyl-CoA acetyltransferase ATCC 14579 of Bacillus cereus Accession No.: NP_834674.1 [20].

Discussion

Four classes of PHA synthase have been classified based on subunit composition of enzymes and their substrate specificities [23]. Bacillus strains belong to class IV synthase that comprises PHAC and its subunit PHAR [24]. The most important genes that involves in PHB production in Bacillus strains were PHAA and PHAR, PHAB, PHAC [3,23]. On the other hand, Valappil et al. [25] and Tomizawa et al. [14] proved that in Bacillus genus, two proteins, PHAC, the normal PHA synthase enzyme, and PHAR have been proven to be essential for the PHA synthase activity. The PHA synthases was exist in two forms; an active form in PHA-accumulating cells and an inactive form in non-accumulating cells, where PHAC is more susceptible to degradation in cell [18].

All PHA genes; PHAA, PHAR, PHAB, PHAC were amplified and assembled together, and then cloned in E. coli. The results showed that PHAA sequence (1186 bp) gave the maximum homology of 99% to acetyl-CoA acetyltransferase of Bacillus thuringiensis BMB171, accession No.: NC_014171.1 (He et al. 2010) and Bacillus cereus ATCC 14579, accession No.: NC_004722.1 [20]. In addition, the sequence data of PHAB fragment was found 745 bp and the BLAST search gave a maximum homology of 98% to many Bacilli strains sequence e.g. acetoacetyl-CoA reductase of Bacillus thuringiensis serovar finitimus YBT-020 NC_017200.1 [21] and Bacillus cereus FRI-35, accession No.: NC_018491.1. Moreover, the sequence data of PHAC was found 1086 bp and the BLAST search of PHAC sequence showed 98% homology to poly(R)-hydroxyalkanoic acid synthase subunit PHAC from Bacillus thuringiensis serovar finitimus YBT-020, accession No. NC_017200.1 [21]. Also, the sequence data of PHAR was 484 bp and the BLAST search of homologous sequence to PHAR showed 99% homology to PHA synthase subunit PHAR; regulator of PHAP of Bacillus cereus ATCC 10987, accession No.: NC_003909.8 [22] and Bacillus thuringiensis serovar finitimus YBT-020, accession No.: NC_017200.1. Finally, the complete sequence of the PHA operon resulted from PCR amplification and sequencing using the specific primers was 4279 bp and the BLAST search gave 98% homology to PHAR proteinacetoacetyl-CoA reductase of Bacillus cereus ATCC 14579, accession No. NC_004722.1 [20]. This result is consistent with many studies in different bacteria such as; Rhodospirillum rubrum [26], Bacillus megaterium [18], Bacillus cereus SPV [25] and Bacillus thuringiensis R1 [4].

It is worthy to mention that in this study, it is the first time to isolate and clone all the four genes; PHAA and PHAR, PHAB, PHAC responsible for PHB production from the same bacterial isolate “Bacillus cereus MM7”, in contrast with the previous studies which used only two or three genes of PHB biosynthetic genes and cloned them in plasmid that carry the remaining PHB biosynthetic gene [4].

The four PHA genes were cloned and expressed in E. coli XL1-Blue and E. coli MJ 109 and the resulting proteins were analyzed using SDS-PAGE [18]. The results of polyacrylamide gel electrophoresis and proteins mass spectrometry data (Mascot software. Matrix science) confirmed that the PHAA (41,13 KD), PHAR (18.5KD) and PHAB (26.54KD) were expressed very well and the their bands in the gel were also clear, but there was no clear protein band in the gel for PHAC (41.69KD) which means that PHAC is probably expressed with very little amounts or not expressed. The MS analysis was performed for the corresponding protein bands for PHB genes according to Slater et al. [27], Valappil et al. [25] and Zhu et al. [13].

The current results showed that using the proteins pellet better than soluble proteins in SDS-PAGE gel to analyze the expression, this may be due to the elongation of PHA chain and PHAsing proteins or the specific proteins that are associated with the produced PHA granules or budding of a vesicle with a phospholipid layer and leading to granule formation [2]. Many other studies used whole-cell extracts for determination of one protein or more of PHA synthesis proteins activity [10,18,28]. In contrast, Zhu et al. [13] used soluble protein to detect PHB expression proteins (PHBA, PHBB and PHBC) which were all expressed at high levels. Moreover, in the current study, the PHB encoding proteins were expressed clearly when using a medium not supplemented with glucose better than using glucose. This result agrees with Davis et al. [10] who used LB media without glucose and noted that PHAC1, PHAJ1, PHAA and PHAB proteins were expressed very clear.

In the current study, the amino acid sequence analysis of the three proteins using MS showed that PHAA was 390 Amino acids with 100% homology to acetyl-CoA acetyltransferase ATCC 14579 of Bacillus cereus Accession No.: NP_834674.1 [20]. PHAB was 247 amino acids and it showed 100% homology with acetoacetyl-CoA reductase (Bacillus cereus ATCC 14579) accession No.: NP_831099.1 [20]. PHAR was 176 amino acids and it showed 89% similarity to hypothetical protein [Bacillus cereus], accession No.: WP_002195298.1. Similar results were obtained in many previous studies which sequenced and analyzed the amino acids of PHB proteins in Rhodospirillum rubrum [26], Pseudomonas sp. [29,30] Bacillus sp. [4,18,25].

In conclusion, Bacillus cereus MM7 isolate was able to synthesize Poly 3-hydroxybutyrate. The PHB genes were isolated, cloned, sequenced and expressed in E. coli DH5α. The PHB encoding proteins were analyzed in SDS-PAGE and the PHB corresponding protein bands were analyzed using mass spectrometry to nominate their amino acid sequence.

Acknowledgment

The authors thank King Abdulaziz City for Science and Technology for financing this research project grant number (1013-12-ت-ط). Thanks also for Fraunhofer Institute for Molecular Biology and Applied Ecology, Germany for awarding the facilities needed to perform this research project.

References

  1. Frieder W (2010) Lichtenthaler "Carbohydrates as Organic Raw Materials". Ullmann's Encyclopedia of Industrial Chemistry.
  2. Sudesh K, Abe H (2010) Practical guide to microbial poly hydroxyl alkanoates. Published by Smithers Rapra Technology, aper back, UK, pp. 158.
  3. Chen G (2010) Plastics from bacteria: natural functions and applications. In: Chen George Guo-Qiang (Ed.), (1st edn), Springer-Verlag Berlin Heidelberg, Germany, p.145.
  4. Desetty R, Mahajan V, Khan B, Rawal S (2008) Isolation and heterologous expression of PHA synthesising genes from Bacillus thuringiensis R1. World Journal of Microbiology and Biotechnology 24(9): 1769-1774.
  5. Van Thuoc D, Huu Phong T, Thi Binh N, Thi Tho N, Minh Lam D, et al. (2012) Polyester production by halophilic and halotolerant bacterial strains obtained from mangrove soil samples located in Northern Vietnam.Microbiologyopen 1(4): 395-406.
  6. Wang H, Li X, Chen G (2009) Production and characterization of homopolymer polyhydroxyheptanoate by a fadBA knockout mutant Pseudomonas putida KTOY06 derived from P. putida KT2442. Process Biochemistry 44(1): 106-111.
  7. Trainer M, Capstick D, Zachertowska A, Lam K, Clark S, et al. (2010) Identification and characterization of the intracellular poly-3-hydroxybutyrate depolymerase enzyme PHAZ of Sinorhizobium meliloti. BMC Microbiol 10: 92.
  8. Ghate B, Pandit P, Kulkarni C, Mungi DD, Patel TS (2011) PHB Production using novel Agro-industrial sources from different Bacillus species. International Journal of PHArma & Bio Sciences 2(3).
  9. Sangkharak K, Prasertsan P (2012) Screening and identification of polyhydroxyalkanoates producing bacteria and biochemical characterization of their possible application. J Gen Appl Microbiol 58(3): 173-182.
  10. Davis R, Anilkumar P, Chandrashekar A, Shamala T (2008) Biosynthesis of polyhydroxyalkanoates co-polymer in E. coli using genes from Pseudomonas and Bacillus. Antonie Van Leeuwenhoek 94 (2): 207-216.
  11. Nikel PI, de Almeida A, Melillo EC, Galvagno MA, Pettinari MJ (2006) New recombinant Escherichia coli strain tailored for the production of poly (3-hydroxybutyrate) from agroindustrial by-products. Appl Environ Microbiol 72(6): 3949-3954.
  12. Li R, Chen Q, Wang PG, Qi Q (2007) A novel-designed Escherichia coli for the production of various polyhydroxyalkanoates from inexpensive substrate mixture. Appl Microbiol Biotechnol 75(5): 1103-1109.
  13. Zhu SW, Fang ZY, Jiang HY, Cheng BJ (2010) Molecular and functional analysis of the poly-β-hydroxybutyrate biosynthesis operon of Pseudomonas sp BJ-1. Genet Mol Res 9(4): 2349-2356.
  14. Tomizawa S, Hyakutake M, Saito Y, Agus J, Mizuno K, et al. (2011) Molecular weight change of polyhydroxyalkanoate (PHA) caused by the PHAC subunit of PHA synthase from Bacillus cereus YB-4 in recombinant Escherichia coli. Biomacromolecules 12(7): 2660-2666.
  15. Aly MM, Albureikan MO, El Rabey H, Kabli S (2013) Effects of culture conditions on growth and poly-β-hydroxybutyric acid production by Bacillus cereus MM7 isolated from soil samples from Saudi Arabia. Life Sci J 10(4): 1884-1891.
  16. Khanna S, Srivastava AK (2006) Optimization of nutrient feed concentration and addition time for production of poly(β-hydroxybutyrate). Enzyme and Microbial Technology 39(5): 1145-1151.
  17. Mizuno K, Ohta A, Hyakutake M, Ichinomiya Y, Tsuge T (2010) Isolation of polyhydroxyalkanoate-producing bacteria from a polluted soil and characterization of the isolated strain Bacillus cereus YB-4. Polymer Degradation and Stability 95(8): 1335-1339.
  18. McCool GJ, Cannon MC (2001) PHAC and PHAR are required for polyhydroxyalkanoic acid synthase activity in Bacillus megaterium.J Bacteriol 183(14): 4235-4243.
  19. He J, Shao X, Zheng H, Li M, Wang J, et al. (2010) Complete genome sequence of Bacillus thuringiensis mutant strain BMB171. J Bacteriol 192 (15): 4074-4075.
  20. Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, et al. (2003) Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 423(6935): 87-91.
  21. Zhu Y, Shang H, Zhu Q, Ji F, Wang P, et al. (2011) Complete genome sequence of Bacillus thuringiensis Serovar finitimus strain YBT-020. J Bacteriol 193(9): 2379-2380.
  22. Rasko DA, Ravel J, Okstad OA, Helgason E, Cer RZ, et al. (2004) The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pXO1. Nucleic Acids Res 32(3): 977-988.
  23. Valappil S, Boccaccini A, Bucke C, Roy I (2007) Polyhydroxyalkanoates in gram-positive bacteria: insights from the genera Bacillus and Streptomyces. Antonie van leeuwenhoek 91(1): 1-17.
  24. Hyakutake M, Saito Y, Tomizawa S, Mizuno K, Tsuge T (2011) Polyhydroxyalkanoate (PHA) synthesis by class IV PHA synthases employing Ralstonia eutroPHA PHB 4 as host strain. Biosci Biotechnol Biochem 75(8): 1615-1617.
  25. Valappil SP, Rai R, Bucke C, Roy I (2008) Polyhydroxyalkanoate biosynthesis in Bacillus cereus SPV under varied limiting conditions and an insight into the biosynthetic genes involved. J Appl Microbiol 104(6): 1624-1635.
  26. Clemente T, Shah D, Tran M, Stark D, Padgette S, et al. (2000) Sequence of PHA synthase gene from two strains of Rhodospirillum rubrum and in vivo substrate specificity of four PHA synthases across two heterologous expression systems. Appl Microbiol Biotechnol 53(4): 420-429.
  27. Slater S, Voige W, Dennis D (1988) Cloning and expression in Escherichia coli of the Alcaligenes eutrophus H16 poly- beta -hydroxybutyrate biosynthetic pathway. J of Bacteriol 170(10): 4431-4436.
  28. Horng YT, Chang KC, Chien CC, Wei YH, Sun YM, et al. (2010) Enhanced polyhydroxybutyrate (PHB) production via the coexpressed PHACAB and vgb genes controlled by arabinose PBAD promoter in Escherichia coli. Lett Appl Microbiol 50(2): 158-167.
  29. Tajima K, Igari T, Nishimura D, Nakamura M, Satoh Y, et al. (2003) Isolation and characterization of Bacillus sp. INT005 accumulating polyhydroxyalkanoate (PHA) from gas field soil. J Biosci Bioeng 95: 77-81.
  30. Nomura C, Taguchi S (2007) PHA synthase engineering toward super biocatalysts for custom-made biopolymers. Appl Microbiol Biotechnol 73(5): 969-979.
© 2014-2016 MedCrave Group, All rights reserved. No part of this content may be reproduced or transmitted in any form or by any means as per the standard guidelines of fair use.
Creative Commons License Open Access by MedCrave Group is licensed under a Creative Commons Attribution 4.0 International License.
Based on a work at http://medcraveonline.com
Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version | Opera |Privacy Policy