Advances in ISSN: 2377-4290 AOVS

Ophthalmology & Visual System
Research Article
Volume 1 Issue 4 - 2014
PAX6 mRNA Transcript Analysis in Various Ocular/Non-Ocular Tissues
Neethirajan G1,2*, Krishnadas SR3, Vijayalakshmi P4, Shashikanth Shetty4 and Sundaresan P1
1Department of Genetics, Aravind Medical Research Foundation, India
2PG & Research Centre in Biotechnology, India
3Department of Glaucoma, Aravind Eye Hospital, India
4Department of Pediatric Ophthalmology and Strabismus, Aravind Eye Hospital, India
Received: August 14, 2014| Published: December 10, 2014
*Corresponding author:G Neethirajan, PG & Research Centre in Biotechnology, MGR College, Adhiyamaan Educational and Research Institution, Hosur-635 109, India, Tel: +91-9790295993; +91-4344-261 004; Fax: +91-4344-260 573; Email: @
Citation: Neethirajan G, Krishnadas SR, Vijayalakshmi P, Shetty S, Sundaresan P (2014) PAX6 mRNA Transcript Analysis in Various Ocular/Non-Ocular Tissues. Adv Ophthalmol Vis Syst 1(4): 00026. DOI: 10.15406/aovs.2014.01.00026

Abstract

PAX6 is a critical regulatory gene located on human chromosome 11p13, is expressed in many ocular tissues, and non-ocular tissues like brain, and pancreas. The expression of mRNA transcript has been investigated in this study since PAX6 is likely to play a vital role in the development of eye. RNA was extracted from various ocular tissues including lens epithelium, retina, iris, non-ocular tissues Trabecular Meshwork cells (TM cell line), HeLa cells. Besides the mutant and wild type blood cells were also included and total RNAs were subjected to convert in to Complementary DNA (cDNA). The high sensitive reverse transcriptase polymerase chain reaction (RT-PCR) was performed to monitor the mRNA transcript level to detect the expression profiles of the ocular/non-ocular tissues taken for this study.
The competitive RT-PCR analysis was carried out using the house keeping gene beta actin as a control in both the ocular and non-ocular tissues. The level of beta actin expression in ocular/non-ocular tissues was equal and showed 540bp amplification. Subsequently the PAX6 mRNA transcript was analysed in these tissues. The expression level of PAX6 was observed in the ocular tissues such as retina, iris and lens epithelium which expressed approximately 600, 855, 1013 and 1055bp amplification. In the non-ocular HeLa cells the PAX6 expression was abnormally high and showed approximately 1.2kb amplification. No PAX6 expression was observed in the wild type WBC cells; however the mutant WBC amplified an irrelevant transcript. Sequencing the irrelevant transcript revealed the homology hint to various chromosomes particularly of hypothetical LOC441763 mRNA.
RT-PCR amplification confirms the presence of various PAX6 mRNA expressions in ocular and non-ocular tissues. Lens epithelium, retina and iris tissues have significant PAX6 expression while the retina contains an overwhelming majority of mRNAs encoding crystallins and other genes but still express PAX6 isoforms at high levels. HeLa is a fibroblast based cell line and it would not expect a fibroblast to express a lot of PAX6 However PAX6 gene expression might be high in these cells for some reason. The PAX6 gene partial expression was found in mutant WBC and not in wild type WBC cells, the real fact for this reason is unknown. PAX6 mutations should be analyzed with effective functional assays, which will be useful for future study.
Keywords:PAX6 mRNA Transcript, TM Cell lines, cDNA, RT-PCR, WBC Lymphocytes

Abbreviations

PAX6 : Paired Box Gene 6; mRNA: Messenger Ribonucleic Acid; cDNA: Complementary Deoxyribonucleic Acid; RT-PCR: Reverse Transcriptase Polymerase Chain Reaction; WBC: White Blood Cells; TM Cells: Trabecular Meshwork Cells; HeLa Cells: Cancer Cell Lines

Introduction

PAX6 is a critical regulatory gene located on human chromosome 11p13, is expressed in many ocular tissues, and non-ocular tissues brain, and pancreas [1]. PAX6 encodes a specific paired and homeo DNA binding transcription factor, which is essential for eye development [2]. PAX6 extends over 22kb and contains 14 exons and intron sequences, in addition, a CCAGCATGC translation start site at exon 4, a TAA stop codon in exon 13. The transcription start site and promoter region with TATA, CAAT, and GC regulatory elements, and three possible polyadenylation signals have all been characterized [3]. PAX6 heterozygous mutation causes aniridia (eye without iris) and other related phenotypes [1] whereas the homozygous PAX6 cause anophthalmia (absence of one or both eyes) and neonatal lethality [4]. Human PAX6 is transcribed as a 2.7kb mRNA and encodes a 422-amino-acid protein that includes the paired box, the homeo box, and a third possible DNA-binding motif, the PST domain (Proline, Serine, and Threonine-rich sequence) [1]. Interestingly, PAX6 contains an alternative mRNA splice-site in the paired domain. This resulted in a 42-nucleotide insertion; the insertion allows the carboxy terminal sub-region of the paired domain to recognize a novel DNA sequence. PAX6 contains an alternative mRNA splice-site which allows to regulate the restricted set of genes depends on the mRNA splicing. These two major forms of the protein, PAX6 and PAX6 (5a) are highly conserved among metazoans (Multicellular animals) [5]. However the over expression of PAX6 (5a) was detected in human congenital cataract [4]. In addition PAX6 (5a) up regulation was observed in transgenic mouse have resulted in lens abnormalities [6]. Therefore, PAX6 transcription factor, which is required for proper eye development, is expressed by normal lens epithelial cells but not in mature fiber cells [7,8,6].
The expression of PAX6 mRNA transcript have been investigated since PAX6 is likely to play a vital role in the development of eye therefore the high sensitive RT-PCR was performed to monitor the PAX6 mRNA transcript level in various ocular tissues like lens epithelium, retina, iris, and non-ocular tissues TM cell line, HeLa RNA and WBC cells.

Materials and Methods

All studies were conducted in accordance with the tenets of the Declaration of Helsinki and the Institutional Review Board of Aravind Eye Care System is approved by Human Research Protection, United States of America. Whole normal human cadaver globe (60 years old) was borrowed from International Aravind Eye Bank after 4 hours of enucleation and microdissected into retina, iris and lens epithelium. Non-ocular tissues like White blood cells with aniridia (obtained after informed consent), Trabecular Meshwork cells (TM Cells cultured in the lab), HeLa RNA (Supplied by Bangalore Genei RT-PCR kit, Banglaore, India) and the Wild type WBC also obtained. 10mg of each tissue and 1.5ml of wild type blood was collected in the presence of an anticoagulant, preferably EDTA or citrate or heparin or acid citrate dextrose and processed to isolate RNA by QIAamp RNA blood mini kit (QIAGEN, GmbH, Germany). QIAamp spin columns are silica-gel based membrane with microspin technology. During the procedure for purification of RNA from ocular and non-ocular tissues were selectively lysed using highly denaturing conditions to inactivate the RNases. After homogenization, the lysate briefly spun through QIAshredder spin column, where the RNA bounds to the silica based matrix. The contaminants were washed with appropriate buffers then the intact cellular RNA was collected in fresh tube using RNase-free water. For the optimal results the ocular/non-ocular tissues were processed immediately after the collection since the mRNA have different stabilities. The isolated total RNA was stored at -200C in DEPC water for approximately 3-6 months. Ribonucleases (RNases) are highly stable and difficult to inactivate hence all the plastic wares and glasswares were treated thoroughly with a solution containing 0.1M NaOH and 1mM EDTA followed by RNase-free water.
Primers
Sequence specific primers were used for RT-PCR analysis. Primers used were synthesised from Microsynth, Switzerland. Besides the published primer [9] another set of primers designed by ABI prism software to amplify the paired domain, PST domain and to amplify the whole PAX6 gene. Details of the primers are sorted out in (Table 1).
RNA quantity/quality analysis
The concentration and purity of RNA determined in to two methods. Gel estimation analysis by visualization and measuring its absorbance at 260 nm and 280 nm in spectrophotometer. The absorbance reading should be greater than 0.15. One unit at 260 nm corresponds to 40μg of RNA per ml. The ratio between the 260/280 nm provides the purity of RNA. The importance of using full-length RNA for reverse transcription depends on the intactness.

S. No.

Primer Name

Nucleotide Sequence

Reference

1

C139

5¢AGAGTGGACAGACATCCGAGA3¢

Hanson et al., 1993 [9]

2

C 402

5¢AATCTTGGCCAGTATTGAGAC3¢

Hanson et al., 1993 [9]

3

C127

5¢GCCAGAGCCAGCATGCAGAAC3¢

Hanson et al., 1993 [9]

4

C401

5¢ATCAGGTTCACTTCCGGGAAC3¢

Hanson et al., 1993 [9]

5

RTF

5¢ACAACCAGAAAGGATGCCTCA3¢

ABI prism software

6

RTR

5¢CCCATCTGTTGCTTTTCGCTA3¢

ABI prism software

7

RTPST

5¢CAGATGTGAAGGAGGAAACCG3¢

ABI prism software

8

b-actin F

5’ CGTCTTCCCCTCCATCG 3’

ABI prism software

9

b-actin R

5’ CTCGTTAATGTCACGCAC 3’

ABI prism software

Table 1: Primers used in RT-PCR analysis to amplify PAX6 gene transcript. RTF: Reverse Transcript Forward Primer; RTR: Reverse Transcript Reverse Primer; RTPST: Reverse Transcript Proline Serine Threonine Region; b-actin: Beta Actin
DNase I digestion
The RNA samples (2μg) were treated with RNase free one μl of DNase I with one μl of 10X buffer and stored at 370C for one hour then the reaction stopped by adding one μl of EDTA (25mM) followed by heating to 650C for 10min to remove possible genomic DNA contamination prior to cDNA conversion. DNase buffer contains cations hence the RNA was heated to degrade the cations in the buffer solution.
RT-PCR and cDNA Conversion
RT-PCR and cDNA Conversion
Generally reverse transcription reactions are performed with one of the primers of randon hexamers or oligonucleotides (Oligo dTs) or an olignucleotide that can hybridize with the specific RNA under the study. However, in this study two types of first strand cDNA (Complementary DNA) conversion were performed in all the RNA samples.
i. RNA with the mixture of oligo-dT and random hexamers
ii. RNA with the mixture of oligo-dT and gene specific primer
One μg of total RNA was heated just before reverse transcription to denature any secondary structure, which could impede the reverse transcriptase from copying the RNA, at 750C for 3 min. The equal amount of oligo-dT and random hexamer (50 μM) added to the final concentration of 5μM [10], with 10.5μl of DEPC water again kept in PCR at 700C again for 5 min. The samples were placed immediately in ice. To the samples the following components were added 1X buffer (500mM Tris-HCl, 750mM KCl, 30mM MgCl2, 50mM DTT), 10mM dNTPs mix, 20U of RNase Inhibitor, 200 U of Moloney Murine Leukemia Virus-Reverse Transcriptase enzymes (Ambion, USA) and the nuclease free DEPC water to the final concentration of 30μl set up. The reaction mixture was incubated at 420C for 1 hour and 950C for 10 min to inactivate the reverse transcriptase enzyme followed by chill on ice. In both types of cDNA conversion gave the consistent results hence either one type can be followed for further study.
PCR analysis
All the resulting cDNA was then amplified with primers specific to both PAX6 and β-actin in a total reaction volume of 20μl. The reaction mix containing 1X polymerase chain reaction (PCR) buffer (10mM Tris-HCl, 50mM KCl) 2mM of MgCl2, 0.25μM of forward and reverse primer and 1unit of Taq DNA polymerase enzyme (Fermentas life science). The PAX6 gene specific and the house keeping gene β-actin primers were used. PCR parameters consist of 5 min denaturing step at 950C followed by 35 cycles (940C for 1 min, 600C for 2 min and 720C for 2 min) and the final extension at 720C for 10 min. For β-actin gene the reaction mix contains 1X buffer, 1.5mM MgCl2, 0.2uM primer and 1 unit of Taq DNA polymerase enzyme (Fermentas). The PCR conditions for β-actin were 940C for 3 min and then cycles for 30 times at 940C for 1.30 min, 520C for 1 min and 720C for 2 min and then 720C for 5 min final extension.
Post PCR electrophoresis
RT-PCR amplified products were resolved and visualized on 2% agarose gel for both PAX6 and β-actin. Electrophoresis was carried out at 100V for 60 min in TAE buffer (0.04 M Tris-acetate, 0.001 M EDTA). Gels were stained with ethidium bromide (5μg/ml) nucleic acid stain. Longer products resolve better on a gel with slightly less agarose.
Minus-RT controls
The importance of minus-reverse transcriptase as control in the RT-PCR experiments to avoid contamination (genomic). This could help that the template for the PCR product was from cDNA and not from the genomic DNA. In the negative control sample all the necessary components were added except the RT enzyme.
Sequencing
The aberrant band expressed in mutant WBC was re-amplified and purified by QIAGEN columns. The PCR products were sequenced directly on an Applied Biosystems (ABI) model 3730 automated sequencer.

Results and Discussion

The expression patterns of PAX6 were analyzed by high sensitive RT-PCR analysis from various ocular tissues of normal cadaver globe obtained from International Aravind Eye Bank and micro dissected. To detect the PAX6 transcript since the eyes formed through serious of interactions between the cells and the embryonic origins that result in lineages of ocular tissues. The total RNA was isolated was resolved on 1% agarose gel to check the integrity of RNA. The extracted RNA subjected for two types of cDNA conversion. These two types of cDNA conversion performed to amplify the PAX6 transcript from the ocular/non-ocular tissues and no significant changes were observed.
The competitive RT-PCR analysis was carried out using the house keeping gene beta actin as a control in both ocular and non-ocular tissues. All the three ocular and four non-ocular tissues such as TM cell HeLa RNA, wild type WBC, mutant WBC RNA was used to amplify the house keeping gene β-actin. Both the ocular/non-ocular tissues expressed the β-actin gene equal levels and showed 540bp amplification. Majority of the genes commonly considered to have a housekeeping function (e.g., β-actin and GAPDH) exhibit considerably variable expression levels from one tissue type to another. However, expression profiles for the maintenance/housekeeping genes exhibit similar patterns for each specific tissue type (Figure 1A). As a primary attempt three samples of ocular tissues such as lens epithelium, normal WBC lymphocytes, and the HeLa RNA were subjected to amplify the PAX6 gene using 5’ paired domain primer. When the RT-PCR products were run on 2.5% agarose gel the lens epithelium showed two PAX6 mRNA transcripts (PAX6 and PAX6 5a isoforms) of approximately 900bp and 1.2kb amplification (Figure IB, lane 3). The PAX6 expression might be abnormally high in HeLa RNA that showed approximately 1.2kb (Figure 1B, lane 1). However, neither PAX6 nor PAX6 (5a) isoforms was observed in the wild type WBC (Figure 1B, lane 2). The PAX6 mRNA transcript was analyzed in the ocular tissues such as retina, iris, and lens epithelium were showing approximately 600, 800, 1013 and 1055bp (Figure 2A, lane 2-4). The various PAX6 mRNA transcripts are consistent with previous published literature [11]. Similar pattern of PAX6 expression profile was also obtained in the non-ocular tissue RNA taken in this study.
The wild type WBC cDNA with or without DNase I treatment does not show PAX6 expression profile and this concludes that the PAX6 is not expressed in wild type WBC cells, However, the housekeeping gene (β-actin) was expressed at equal levels. TM cell line RNA also showed various PAX6 mRNA transcripts approximately of 1000, 800 and 600bp amplification (Figure 2A, lane 6). No amplification was found in the negative controls of ocular retina RNA (Figure 2A, lane 8) and non-ocular wild type WBC (Figure 2A, lane 9). The banding pattern of PAX6 isoforms in ocular and non-ocular tissues is shown in (Table 2).
Figure 1: A: Expression of housekeeping gene (β-actin) amplification of various ocular/non-ocular tissues. Lane 1-Retina, lane 2-iris, lane 3-lens epithelium, lane 4-normal WBC without DNase I, lane 5-TM cell line, lane 6-WBC with DNase I digestion, lane 7-WBC RNA without RT enzyme as negative control. M- 50bp marker. B: PAX6 expression profiles in HeLa RNA and lens epithelium. M-1 kb marker, lane 1-HeLa RNA showing the unusual PAX6 expression and no isoform of 5a. lane 2-wild type WBC RNA, lane 3-Lens epithelium showing both isoforms of PAX6 and PAX6 (5a).
After optimization of RT-PCR in wild type WBC, the further analysis was performed in familial aniridic patients whom the mutation was confirmed by genomic PCR (c.710delC) in mother and child [12]. The both mutant mother and child WBC RNA was subjected for the PAX6 expression after RT-PCR the products were resolved on 2% agarose gel showed unusually two bands of unexpected size amplification approximately 190bp, 200bp (Figure 2B). The unusual PCR products were then reamplified and purified for sequencing purpose (Figure 2C). The sequencing chromatogram is shown in Figure 3A and the blast hit alignments (Figure 3B) identified 85% of homology refers to various chromosomes (Figure 3C), but the prime hit to Homo sapiens chromosome 16 genomic contig, reference assembly (Accession Number NT_010393). The evidence based on nucleotide supports the gene description is similar to Homo sapiens hypothetical LOC441763, mRNA (ACCESSION XM_930284) however, 15% resembling as PAX6 (Homo sapiens paired box gene 6 (Aniridia, keratitis, PAX6 transcript variant 2, mRNA) homology in the blast search (Figure 3D).
Figure 2: A: PAX6 mRNA transcripts of various ocular tissues by RT-PCR analysis. M-1kb marker, 1-Empty, 2-Retina cDNA with oligo dTs and gene specific primers, 3-Iris, 4-lens epithelium, 5- Wild type WBC cDNA without DNase I treatment, 6-TM cell line with oligo dTs and gene specific, 7-empty, 8- Wild type WBC cDNA with DNase I treatment, 9-Retina cDNA without RT enzyme as negative control. B: PAX6 expression pattern in WBC showing abnormal banding pattern in affected individual & amplicon purification. M-100bp Marker, lane 1-Mutant mother showing the amplification, lane 2-Affected proband shows the same amplification. C: Lane 3, 4-Showing approximately 190bp, 200bp of purified RT-PCR product for sequencing.

S. No

Ocular Tissues

Non-Ocular Tissues

Beta actin

Isoforms of PAX6 and PAX6 (5a)

1

Retina

 

540bp

600bp, 800bp, 1kb, 1.1kb

2

Iris

 

540bp

600bp, 800bp, 1kb, 1.1kb

3

Lens Epithelium

 

540bp

600bp, 800bp, 1kb, 1.1kb

4

 

Wild WBC without DNase I digest

540bp

-

5

 

TM Cell Line

540bp

600bp, 800bp, 1kb

6

 

Wild WBC with DNase I digest

540bp

-

7

 

HeLa Cell line

540bp

1.2kb

8

 

Mutant WBC

-

190bp, 200bp

9

Retina cDNA (without RT enzyme)

 

Negative control

Negative control

10

 

WBC RNA without RT enzyme

Negative control

Negative control

Table 2: Description of the PAX6 mRNA transcript isoforms products in ocular and non-ocular tissues. bp: Base Pair; cDNA: Complementary DNA; RT: Reverse Transcriptase; TM cell line: Trabecular Meshwork Cells: WBC: White Blood Cells
Figure 3: Figure 3A-3’ sequencing result of aberrent banding pattern in mutant WBC lymphocytes, Figure 3B- Homology result indicates the blast hit identified 85% of homology refers to Homo sapiens chromosome 16 genomic contig, reference assembly, However, the evidence based on nucleotide supports the description of gene, is similar to Homo sapiens hypothetical LOC441763 (LOC441763), mRNA. Figure 3C- Homology of nucleotide sequences that correlates to other chromosomes (Red mark shows the location). Figure 3D-15% homology of mutant WBC lymphocytes shows PAX6 .
Partial PAX6 is illegitimately expressed in mutant WBC lymphocytes and not in wild type WBC lymphocytes hence it needs to explore the function of PAX6 mRNA in mutant. These results suggest that the PAX6 gene expression patterns of is highly variable in each ocular/non-ocular tissue types and most likely related to differences in metabolic activity hence the human tissues of an individual may contribute to gene-specific expression pattern. In this study the normal cadaver eye (60 years old) had been taken because the tissue ocular tissues specific genes are expressed more, which is an important model to understand the molecular basis in patterning the expressing gene of PAX6 . The expression level of PAX6 is moderately high in ocular tissues like cornea, lens epithelium, lens etc., hence cadaver globe was borrowed and the analysis done as a control. Approximately 451 genes have been expressed in normal human tissues and designated as housekeeping genes. These genes display significant variation in expression pattern in tissues [13], but no attempt have been made to amplify these genes except β-actin.
The non-ocular tissues like normal WBC cells, mutant WBC, TM cell lines and HeLa cells were also analyzed for the expression pattern of PAX6 . Since PAX6 was first identified in 1991 [14], more information has been accumulated during the past decade. PAX6 is essential for normal vision however, the genes directly regulated by PAX6 are unknown [15]. In this present data lens epithelium, retina and iris tissues have significant PAX6 expression while the retina contains an overwhelming majority of mRNAs encoding crystallins and other genes but they still express PAX6 isoforms at high levels. Surprisingly in HeLa RNA showed PAX6 expression since the HeLa cells are a fibroblast based cell line and it would not expect a fibroblast to express, a lot of PAX6 However PAX6 expression might be high in these cells for some reason.
To gain into the transcriptional competence the corresponding level of β-actin was examined. β-actin has been used as standard determination of absolute levels of genes expressed in a population of eukaryotic cells. The housekeeping gene b-actin was taken as a control in analyzing the ocular and non-ocular tissues because b-actin is essential for the cell proliferation, activation, and differentiation. In this report the all the ocular/non-ocular tissues showing equal level of beta actin expression. Β-actin commonly assumed to have constant expression level which could provide new standards for quantitative controls of expression gene. The TM cell line selected because the cells cultured in-vitro has high transcriptional modification during culture and the number of cells is relatively high. The transcriptional activity has strongly modulated by cell density. Indeed the expression of both isoforms was dramatically increased in proliferative cells [16].
Various studies in the development of eye and gene regulation provide substantial evidences that the single gene PAX6 play crucial role not only in eye but also in non-ocular tissues like brain, olfactory, pituitary, pancreas, and spinal cord expression. However, it has been documented in HeLa RNA, which expresses PAX6 aberrantly in this study [17]. Evidences showed that PAX6 plays autonomous role in lens [18,19] and non-autonomous role in other ocular cells [20,21]. Even though equal amount (50ng) of RNA was taken as a standard for the analysis, hence the PAX6 mRNA in adult retina showing more intensity when compared with non-ocular tissues taken in this study. This was confirmed by several repeated RT-PCR analysis and the intensity was observed so high in retinal cells. This concludes that the PAX6 is highly expressed in retina, which is consistent with previous publication [22].
In this report, the abnormal bands detected in aniridic patients and the sequencing result revealed that the 15% homology similar to PAX6 nucleotide with C-terminal ends. Hence, the expressed bands were not an artifact of RT-PCR method, but a true biological phenomenon. The real function of alternatively spliced isoform is still controversial and the importance of the isoform might play role in mutants. The PAX6 partial expression in mutant WBC cell was found and not in normal WBC cells, the real fact for this reason in unknown. However, in lymphocytes PAX6 is definitely expressed at extremely low levels, therefore lymphocytes RNA was done PCR with several methods but failed to get amplification. The study gives further evidence that the mutant transcription was analyzed and is consistent with previous literature [23]. The absence of PAX6 expression was observed in wild type WBC cells. In contrary, the molecular studies on PAX6 missense mutations produce putative abnormal amino acid substitution resulted in aniridia and related phenotypes likewise the PAX6 frame shift mutations needs further exploration to detect the exact mechanism with the natural PAX6 [5,12,24].

Conclusion

The opposing debate is why the mutations are analyzed in the genomic level in blood cells but not in the mRNA level, that mean the mRNAs are not produced in WBC cells or in truncated form or it is degraded hence it needs to be explored further for the tissue specific expression. To conclude the various types of mutations should be analyzed at least to the mRNA level instead of genomic/protein level because very less transcript information is available. PAX6 mRNA transcript are present in ocular/non-ocular tissues hence the PAX6 mutations should be analyzed with effective functional assays, which will be useful to find the transcript level. Further studies will focus on the expression levels that are altered in PAX6 and other ocular tissues evaluating their expression pattern during eye development and its functional role.

Acknowledgements

The authors are very thankful to the participants in this study. The Indian Council of Medical Research (ICMR), New Delhi, India, Financially supported in this study. The authors also thank the anonymous reviewers.

References

  1. Glaser T, Waltson DS, Cai J, Epstein JA, Jepeal L, et al. (1995) PAX6 gene mutations in aniridia. In: J Wiggs (Ed.), Molecular Genetics of Ocular Disease. Wiley-Liss Inc., Wilmington, USA, pp. 250.
  2. Chow RL, Altmann CR, Lang RA, Hemmati-Brivanlou A (1999) PAX6 induces ectopic eyes in a vertebrate. Development 126(19): 4213-4222.
  3. Glaser T, Walton DS, Maas RL (1992) Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nat Genet 2(3): 232-239.
  4. Glaser T, Jepeal L, Edwards JG, Young SR, Favor J, et al. (1994) PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat Genet 7(4): 463-471.
  5. Epstein JA, Glaser T, Cai J, Jepeal L, Walton DS, et al. (1994) Two independent and interactive DNA-binding subdomains of the PAX6 paired domain are regulated by alternative splicing. Genes Dev 8(17): 2022-2034.
  6. Duncan MK, Cvekl A, Li X, Piatigorsky J (2000) Truncated forms of Pax-6 disrupts lens morphology in transgenic mice. Invest Ophthalmol Vis Sci 41(2): 464-473.
  7. Walther C, Gruss P (1991) Pax-6, a murine paired box gene, is expressed in the developing CNS. Development 113(4): 1435-1449.
  8. Koroma BM, Yang JM, Sundin OH (1997) The Pax-6 homeobox gene is expressed throughout the corneal and conjunctival epithelia. Invest Ophthalmol Vis Sci 38(1): 108-120.
  9. Hanson IM, Seawright A, Hardman K, Hodgson S, Zaletayev D, et al. (1993) PAX6 mutations in aniridia. Hum Mol Genet 2(7): 915-920.
  10. Innis MA, Gelfand DH, Sninsky JJ, White TJ (1990) PCR Protocols-A Guide to Methods and Application. Academic Press, California, USA, pp. 482.
  11. Gronskov K, Rosenberg T, Sand A, Brondum-Nielsen K (1999) Mutational analysis of PAX6 : 16 novel mutations including 5 missense mutations with a mild aniridia phenotype. Eur J Hum Genet 7(3): 274-286.
  12. Neethirajan G, Nallathambi J, Krishnadas SR, Vijayalakshmi P, Shashikanth S, et al. (2006) Identification of Novel Mutant PAX6 Alleles in Indian cases of Familial Aniridia. BMC Ophthalmol 6:28.
  13. Hsiao LL, Dangond F, Yoshida T, Hong R, Jensen RV, et al. (2001) A compendium of gene expression in normal human tissues. Physiol Genomics 7(2): 97-104.
  14. Ton CC, Hirvonen H, Miwa H, Weil MM, Monaghan P, et al. (1991) Positional cloning and characterization of a paired-box and homeobox-containing gene from the aniridia region. Cell 67(6): 1059-1074.
  15. Chauhan BK, Reed NA, Yang Y, Cermak L, Reneker L, et al. (2002) A comparative cDNA microarray analysis reveals a spectrum of genes regulated by PAX6 in mouse lens. Genes Cells 7(12): 1267-1283.
  16. Sivak JM, Mohan R, Rinehart WB, Xu PX, Maas RL, et al. (2000) Pax-6 expression and activity are induced in the reepithelializing cornea and control activity of the transcriptional promoter for matrix metalloproteinase gelatinase B. Dev Biol 222(1): 41-54.
  17. Simpson TI, Price DJ (2002) PAX6 , a pleiotropic player in development. Bioessays 24(11): 1041-1051.
  18. Quinn JC, West JD, Hill RE (1996) Multiple functions for PAX6 in mouse eye and nasal development. Genes Dev 10(4): 435-446.
  19. Collinson JM, Quinn JC, Buchanan MA, Kaufman MH, Wedden SE, et al. (2001) Primary defects in the lens underlie complex anterior segment abnormalities of the PAX6 heterozygous eye. Proc Natl Acad Sci U S A 98(17): 9688-9693.
  20. Collinson JM, Quinn JC, Hill RE, West JD (2003) The roles of PAX6 in the cornea, retina, and olfactory epithelium of the developing mouse embryo. Dev Biol 255(2): 303-312.
  21. Collinson JM, Chanas SA, Hill RE, West JD (2004) Corneal development, limbal stem cell function, and corneal epithelial cell migration in the PAX6 (+/-) mouse. Invest Ophthalmol Vis Sci 45(4): 1101-1108.
  22. Stanescu D, Iseli HP, Schwerdtfeger K, Ittner LM, Reme CE, et al. (2007) Continuous expression of the homeobox gene PAX6 in the ageing human retina. Eye (Lond) 21(1): 90-93.
  23. Gronskov K, Olsen JH, Sand A, Pedersen W, Carlsen N, et al. (2001) Population-based risk estimates of Wilms tumor in sporadic aniridia. A comprehensive mutation screening procedure of PAX6 identifies 80% of mutations in aniridia. Hum Genet 109(1): 11-18.
  24. Chauhan BK, Yang Y, Cveklova K, Cvekl A (2004) Functional properties of natural human PAX6 and PAX6 (5a) mutants. Invest Ophthalmol Vis Sci 45(2): 385-392.
© 2014-2016 MedCrave Group, All rights reserved. No part of this content may be reproduced or transmitted in any form or by any means as per the standard guidelines of fair use.
Creative Commons License Open Access by MedCrave Group is licensed under a Creative Commons Attribution 4.0 International License.
Based on a work at http://medcraveonline.com
Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version | Opera |Privacy Policy